\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007140460:

Variant ID: vg1007140460 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7140460
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGCTCGCCTGCGCTCTTCTGCTGCGGCGAGCTTGGCATCCTGCTGACGCCGAGTGCTCGAGGCGACCGAACGCCGAGACCGAACGTCGGACATGGCGC[G/T]
CCTTCGGGGGGCTGCTGTGTGGAGAGGGGTAAGGGAAAGGGGAAGGAGGAGCAGCTGGTGCTGCTGCTGCGGCTGGCTGAGAGCTCAACCGAGCTTGGGA

Reverse complement sequence

TCCCAAGCTCGGTTGAGCTCTCAGCCAGCCGCAGCAGCAGCACCAGCTGCTCCTCCTTCCCCTTTCCCTTACCCCTCTCCACACAGCAGCCCCCCGAAGG[C/A]
GCGCCATGTCCGACGTTCGGTCTCGGCGTTCGGTCGCCTCGAGCACTCGGCGTCAGCAGGATGCCAAGCTCGCCGCAGCAGAAGAGCGCAGGCGAGCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 20.30% 0.38% 2.37% NA
All Indica  2759 65.90% 34.00% 0.07% 0.04% NA
All Japonica  1512 90.90% 0.70% 1.06% 7.34% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 17.10% 82.70% 0.17% 0.00% NA
Indica II  465 83.70% 16.30% 0.00% 0.00% NA
Indica III  913 85.10% 14.80% 0.11% 0.00% NA
Indica Intermediate  786 69.80% 30.00% 0.00% 0.13% NA
Temperate Japonica  767 84.20% 0.50% 1.83% 13.43% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 0.80% 0.83% 3.32% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007140460 G -> T LOC_Os10g12770.1 upstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:58.856; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1007140460 G -> T LOC_Os10g12780.1 upstream_gene_variant ; 6.0bp to feature; MODIFIER silent_mutation Average:58.856; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1007140460 G -> T LOC_Os10g12790.1 downstream_gene_variant ; 1889.0bp to feature; MODIFIER silent_mutation Average:58.856; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1007140460 G -> T LOC_Os10g12780-LOC_Os10g12790 intergenic_region ; MODIFIER silent_mutation Average:58.856; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg1007140460 G -> DEL N N silent_mutation Average:58.856; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007140460 3.32E-07 4.73E-40 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 2.98E-06 5.94E-22 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 2.55E-06 1.61E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 3.24E-08 1.20E-09 mr1114 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 5.65E-08 5.08E-09 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.27E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 1.54E-06 1.06E-18 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 4.27E-06 2.27E-06 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 3.14E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 8.65E-07 5.13E-37 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 9.98E-06 5.07E-20 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 8.25E-06 1.37E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 2.41E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 7.23E-24 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 2.79E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 2.08E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 7.95E-06 5.77E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.39E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.06E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 4.36E-20 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 5.92E-06 2.77E-24 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 3.53E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.49E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 3.88E-07 2.83E-39 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 8.17E-22 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 2.10E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.47E-29 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 6.77E-07 5.72E-28 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 4.62E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 1.28E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 3.95E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007140460 NA 2.65E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251