\
| Variant ID: vg1007139747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7139747 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTCCTACTCCTTGCGGAGTGCCTGCGGTGTGGACTTGCGGACGCGGTCGCTGCCGATGCATGCCGCAGCGATGGCGTCCCAGGCCTCCTTGGCAGTCGG[A/C]
TTCTGGGAAAGCGAGAACTTCATCTCGGGCGGGACTGCAGCGATGAGGGCATCCAGTGCCCGCCGATCGTCACCATAGTCGACGTCGCCATACCGAACTG
CAGTTCGGTATGGCGACGTCGACTATGGTGACGATCGGCGGGCACTGGATGCCCTCATCGCTGCAGTCCCGCCCGAGATGAAGTTCTCGCTTTCCCAGAA[T/G]
CCGACTGCCAAGGAGGCCTGGGACGCCATCGCTGCGGCATGCATCGGCAGCGACCGCGTCCGCAAGTCCACACCGCAGGCACTCCGCAAGGAGTAGGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 20.80% | 1.69% | 1.46% | NA |
| All Indica | 2759 | 93.30% | 3.20% | 2.65% | 0.83% | NA |
| All Japonica | 1512 | 40.00% | 56.80% | 0.26% | 2.91% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.20% | 0.17% | 0.17% | NA |
| Indica II | 465 | 92.30% | 1.90% | 4.30% | 1.51% | NA |
| Indica III | 913 | 92.90% | 2.70% | 2.74% | 1.64% | NA |
| Indica Intermediate | 786 | 93.50% | 3.10% | 3.44% | 0.00% | NA |
| Temperate Japonica | 767 | 31.80% | 62.20% | 0.39% | 5.61% | NA |
| Tropical Japonica | 504 | 51.60% | 48.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 41.90% | 58.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 34.40% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007139747 | A -> C | LOC_Os10g12780.1 | missense_variant ; p.Asn236Lys; MODERATE | nonsynonymous_codon | Average:66.667; most accessible tissue: Minghui63 young leaf, score: 80.234 | possibly damaging |
-1.714 |
TOLERATED | 1.00 |
| vg1007139747 | A -> DEL | LOC_Os10g12780.1 | N | frameshift_variant | Average:66.667; most accessible tissue: Minghui63 young leaf, score: 80.234 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007139747 | NA | 5.12E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | NA | 5.28E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | NA | 2.16E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | NA | 3.50E-10 | mr1622 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | NA | 9.06E-07 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | NA | 9.80E-10 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007139747 | 1.04E-06 | 1.45E-27 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |