\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007139747:

Variant ID: vg1007139747 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 7139747
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTACTCCTTGCGGAGTGCCTGCGGTGTGGACTTGCGGACGCGGTCGCTGCCGATGCATGCCGCAGCGATGGCGTCCCAGGCCTCCTTGGCAGTCGG[A/C]
TTCTGGGAAAGCGAGAACTTCATCTCGGGCGGGACTGCAGCGATGAGGGCATCCAGTGCCCGCCGATCGTCACCATAGTCGACGTCGCCATACCGAACTG

Reverse complement sequence

CAGTTCGGTATGGCGACGTCGACTATGGTGACGATCGGCGGGCACTGGATGCCCTCATCGCTGCAGTCCCGCCCGAGATGAAGTTCTCGCTTTCCCAGAA[T/G]
CCGACTGCCAAGGAGGCCTGGGACGCCATCGCTGCGGCATGCATCGGCAGCGACCGCGTCCGCAAGTCCACACCGCAGGCACTCCGCAAGGAGTAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 20.80% 1.69% 1.46% NA
All Indica  2759 93.30% 3.20% 2.65% 0.83% NA
All Japonica  1512 40.00% 56.80% 0.26% 2.91% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 94.50% 5.20% 0.17% 0.17% NA
Indica II  465 92.30% 1.90% 4.30% 1.51% NA
Indica III  913 92.90% 2.70% 2.74% 1.64% NA
Indica Intermediate  786 93.50% 3.10% 3.44% 0.00% NA
Temperate Japonica  767 31.80% 62.20% 0.39% 5.61% NA
Tropical Japonica  504 51.60% 48.00% 0.20% 0.20% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 60.00% 34.40% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007139747 A -> C LOC_Os10g12780.1 missense_variant ; p.Asn236Lys; MODERATE nonsynonymous_codon Average:66.667; most accessible tissue: Minghui63 young leaf, score: 80.234 possibly damaging -1.714 TOLERATED 1.00
vg1007139747 A -> DEL LOC_Os10g12780.1 N frameshift_variant Average:66.667; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007139747 NA 5.12E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 NA 5.28E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 NA 2.16E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 NA 3.50E-10 mr1622 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 NA 9.06E-07 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 NA 9.80E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007139747 1.04E-06 1.45E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251