\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1007118237:

Variant ID: vg1007118237 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 7118237
Reference Allele: AAlternative Allele: AGGGG,G,AGGG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGCTATCATGGTAGTTCAGCTGGGAGAAAGGTAGCATAGCCTTTTGACTTCATTTGCAAGGGATTGGTATAGGTCAGAGAGAATGGGAGAGAGAGAG[A/AGGGG,G,AGGG]
GGGGGAGGGAGAGAGAGAGAGAATTGCATTTGTTTAACCGGTTGTTAAAGTTTGTTGAGGGATTTGGTAGCAACGGGGTCATCATGTTGCACTTTTTCTA

Reverse complement sequence

TAGAAAAAGTGCAACATGATGACCCCGTTGCTACCAAATCCCTCAACAAACTTTAACAACCGGTTAAACAAATGCAATTCTCTCTCTCTCTCCCTCCCCC[T/CCCCT,C,CCCT]
CTCTCTCTCTCCCATTCTCTCTGACCTATACCAATCCCTTGCAAATGAAGTCAAAAGGCTATGCTACCTTTCTCCCAGCTGAACTACCATGATAGCAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 22.70% 24.21% 9.63% AGGGG: 19.04%; AGGG: 0.02%
All Indica  2759 22.10% 3.60% 33.09% 9.24% AGGGG: 31.93%; AGGG: 0.04%
All Japonica  1512 12.10% 62.10% 12.63% 12.50% AGGGG: 0.66%
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 3.20% 5.00% 9.24% 2.35% AGGGG: 80.17%
Indica II  465 23.90% 1.70% 46.24% 13.12% AGGGG: 15.05%
Indica III  913 33.30% 3.30% 37.46% 12.60% AGGGG: 13.36%
Indica Intermediate  786 22.30% 4.10% 38.30% 8.27% AGGGG: 26.97%; AGGG: 0.13%
Temperate Japonica  767 11.50% 70.70% 3.00% 14.47% AGGGG: 0.39%
Tropical Japonica  504 15.10% 48.20% 26.19% 9.52% AGGGG: 0.99%
Japonica Intermediate  241 7.90% 63.90% 14.94% 12.45% AGGGG: 0.83%
VI/Aromatic  96 70.80% 2.10% 20.83% 6.25% NA
Intermediate  90 30.00% 35.60% 18.89% 5.56% AGGGG: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1007118237 A -> DEL N N silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGGG LOC_Os10g12750.1 upstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGGG LOC_Os10g12760.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGGG LOC_Os10g12750-LOC_Os10g12760 intergenic_region ; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> G LOC_Os10g12750.1 upstream_gene_variant ; 2065.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> G LOC_Os10g12760.1 downstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> G LOC_Os10g12750-LOC_Os10g12760 intergenic_region ; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGG LOC_Os10g12750.1 upstream_gene_variant ; 2066.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGG LOC_Os10g12760.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N
vg1007118237 A -> AGGG LOC_Os10g12750-LOC_Os10g12760 intergenic_region ; MODIFIER silent_mutation Average:78.393; most accessible tissue: Minghui63 root, score: 94.506 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1007118237 A AGGG -0.12 -0.06 -0.03 -0.09 -0.09 -0.09
vg1007118237 A AGGGG -0.12 -0.05 -0.02 -0.06 -0.05 -0.06
vg1007118237 A G 0.0 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1007118237 2.65E-06 1.85E-19 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 2.56E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 2.43E-06 3.89E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 8.41E-07 1.10E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 8.23E-08 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 2.64E-08 3.12E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 8.31E-07 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.07E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 1.74E-06 6.43E-19 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 6.75E-07 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 5.68E-08 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 6.94E-06 6.75E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.40E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.67E-09 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 1.95E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 1.27E-06 2.52E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 4.73E-06 NA mr1622 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 2.31E-07 1.14E-12 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 2.33E-06 1.75E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 4.12E-07 2.75E-07 mr1917 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.36E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 6.75E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 1.15E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.04E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 3.27E-08 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 4.81E-09 2.45E-28 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 1.26E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 3.68E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 1.52E-06 6.92E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 7.12E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 6.42E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 1.63E-07 1.72E-21 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 8.92E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 9.87E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 4.15E-10 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 4.89E-08 1.00E-29 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 2.28E-12 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 4.56E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 4.08E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 6.95E-07 NA mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 2.58E-17 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 9.43E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 1.29E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 9.93E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1007118237 NA 1.72E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251