\
| Variant ID: vg1007003848 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 7003848 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAAGAGGCAACTCAAGCCTCGGAGTCCTGAAAAGAAGATACCTATTGACTCGAGCGTGAAGAACTTCTTCAAGGGAATGTCCAAAACAAACAAGGAGGT[G/A]
TTACAGATATCGGACTATGACCGAACACTTCAGAGAGCCTATCACAAGAAGTCCAAACCAGTCCCTTAGCTTGGAGAACAACCAAACCAAGAGGTCGAGC
GCTCGACCTCTTGGTTTGGTTGTTCTCCAAGCTAAGGGACTGGTTTGGACTTCTTGTGATAGGCTCTCTGAAGTGTTCGGTCATAGTCCGATATCTGTAA[C/T]
ACCTCCTTGTTTGTTTTGGACATTCCCTTGAAGAAGTTCTTCACGCTCGAGTCAATAGGTATCTTCTTTTCAGGACTCCGAGGCTTGAGTTGCCTCTTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.80% | 9.50% | 31.04% | 31.65% | NA |
| All Indica | 2759 | 3.00% | 11.40% | 35.09% | 50.53% | NA |
| All Japonica | 1512 | 75.10% | 4.40% | 18.92% | 1.52% | NA |
| Aus | 269 | 0.70% | 21.60% | 55.76% | 21.93% | NA |
| Indica I | 595 | 2.90% | 6.20% | 17.31% | 73.61% | NA |
| Indica II | 465 | 2.60% | 7.50% | 34.41% | 55.48% | NA |
| Indica III | 913 | 4.10% | 16.90% | 48.74% | 30.34% | NA |
| Indica Intermediate | 786 | 2.20% | 11.20% | 33.08% | 53.56% | NA |
| Temperate Japonica | 767 | 94.00% | 0.90% | 3.91% | 1.17% | NA |
| Tropical Japonica | 504 | 51.40% | 9.50% | 37.50% | 1.59% | NA |
| Japonica Intermediate | 241 | 64.70% | 5.00% | 27.80% | 2.49% | NA |
| VI/Aromatic | 96 | 53.10% | 7.30% | 39.58% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 4.40% | 27.78% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1007003848 | G -> A | LOC_Os10g12570.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:21.69; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1007003848 | G -> A | LOC_Os10g12580.1 | downstream_gene_variant ; 2476.0bp to feature; MODIFIER | silent_mutation | Average:21.69; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg1007003848 | G -> DEL | N | N | silent_mutation | Average:21.69; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1007003848 | NA | 3.62E-08 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | NA | 5.97E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | NA | 1.30E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | 1.07E-06 | 3.62E-07 | mr1768 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | NA | 3.34E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | NA | 3.76E-12 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1007003848 | NA | 1.33E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |