Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006959353:

Variant ID: vg1006959353 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 6959353
Reference Allele: TA	Alternative Allele: AA,T
Primary Allele: TA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTTCCGCGCGCACGCTTTAAAACTGCTAAACGGTGTATTTTTTGTAAAAAGTTTCTGTACGAAAGTTGTTTAAAAAAAATCATATTTATCCACTTTTT[TA/AA,T]
AAAAAATTAGCTAATGCTTAATTAACCATGTGCTAATCGATTACTCCGTTTTCCGTGCGCAATGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCT

Reverse complement sequence

AGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACATTGCGCACGGAAAACGGAGTAATCGATTAGCACATGGTTAATTAAGCATTAGCTAATTTTTT[TA/TT,A]
AAAAAGTGGATAAATATGATTTTTTTTAAACAACTTTCGTACAGAAACTTTTTACAAAAAATACACCGTTTAGCAGTTTTAAAGCGTGCGCGCGGAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	47.90%	0.42%	0.93%	T: 0.02%
All Indica	2759	37.50%	61.80%	0.47%	0.18%	NA
All Japonica	1512	83.40%	16.20%	0.26%	0.07%	T: 0.07%
Aus	269	7.80%	92.20%	0.00%	0.00%	NA
Indica I	595	88.60%	11.40%	0.00%	0.00%	NA
Indica II	465	17.40%	81.90%	0.65%	0.00%	NA
Indica III	913	18.60%	80.40%	0.55%	0.44%	NA
Indica Intermediate	786	32.70%	66.50%	0.64%	0.13%	NA
Temperate Japonica	767	94.90%	5.00%	0.13%	0.00%	NA
Tropical Japonica	504	72.60%	26.80%	0.40%	0.00%	T: 0.20%
Japonica Intermediate	241	69.30%	29.90%	0.41%	0.41%	NA
VI/Aromatic	96	31.20%	30.20%	3.12%	35.42%	NA
Intermediate	90	54.40%	41.10%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006959353	TA -> AA	LOC_Os10g12520.1	downstream_gene_variant ; 3082.0bp to feature; MODIFIER	silent_mutation	Average:28.565; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1006959353	TA -> AA	LOC_Os10g12500-LOC_Os10g12520	intergenic_region ; MODIFIER	silent_mutation	Average:28.565; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1006959353	TA -> T	LOC_Os10g12520.1	downstream_gene_variant ; 3081.0bp to feature; MODIFIER	silent_mutation	Average:28.565; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1006959353	TA -> T	LOC_Os10g12500-LOC_Os10g12520	intergenic_region ; MODIFIER	silent_mutation	Average:28.565; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg1006959353	TA -> DEL	N	N	silent_mutation	Average:28.565; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006959353	NA	5.98E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	2.68E-07	2.03E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	5.93E-06	2.13E-09	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	7.50E-07	2.80E-09	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	2.55E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	1.80E-06	3.38E-08	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	5.67E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	1.69E-09	9.65E-23	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	4.48E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	8.56E-08	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	3.79E-07	3.25E-19	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	9.18E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	3.79E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	3.69E-08	1.39E-27	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	7.04E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	4.27E-10	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	6.36E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	1.16E-07	4.91E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	7.60E-07	4.34E-14	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	4.55E-06	1.73E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	3.68E-06	7.73E-09	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	3.73E-06	9.09E-09	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	6.97E-06	5.53E-07	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	5.16E-07	1.59E-27	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	1.93E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	4.80E-06	5.41E-07	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	1.01E-07	6.39E-12	mr1120_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	2.45E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	8.19E-07	NA	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	5.80E-07	2.10E-20	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	1.46E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	9.35E-07	6.72E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	6.14E-06	NA	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	3.75E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	6.06E-29	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	5.14E-09	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	7.77E-09	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	1.01E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	6.58E-18	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	4.18E-09	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	2.47E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006959353	NA	6.90E-08	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251