\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006914384:

Variant ID: vg1006914384 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 6914384
Reference Allele: CAAlternative Allele: C,AA,CAA
Primary Allele: CASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATCTTTGTGTGAACCACATGTAATTTTTGTAACCTTGTAAATATTTTCTTGCTCTATAAAATTACACTGCTAGGCAAAGCCCTGGCAGTTTTCCTGGT[CA/C,AA,CAA]
AAAAAAAAAGATGTTACCCTTTGAGCATTCGCACGGGGGCTATTTCTATTTAATATTCTGTCCGGAGTATTGATTTTAGGAAAGTTCTATTCAACGCTGT

Reverse complement sequence

ACAGCGTTGAATAGAACTTTCCTAAAATCAATACTCCGGACAGAATATTAAATAGAAATAGCCCCCGTGCGAATGCTCAAAGGGTAACATCTTTTTTTTT[TG/G,TT,TTG]
ACCAGGAAAACTGCCAGGGCTTTGCCTAGCAGTGTAATTTTATAGAGCAAGAAAATATTTACAAGGTTACAAAAATTACATGTGGTTCACACAAAGATAC

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 16.40% 4.74% 0.28% CAA: 7.47%; C: 1.16%
All Indica  2759 74.10% 20.00% 4.46% 0.47% CAA: 0.62%; C: 0.33%
All Japonica  1512 58.50% 13.60% 6.48% 0.00% CAA: 21.16%; C: 0.26%
Aus  269 97.80% 1.10% 0.00% 0.00% CAA: 0.74%; C: 0.37%
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 76.30% 19.40% 3.44% 0.22% CAA: 0.43%; C: 0.22%
Indica III  913 54.00% 34.00% 9.09% 0.88% CAA: 1.42%; C: 0.66%
Indica Intermediate  786 77.90% 18.20% 2.93% 0.51% C: 0.25%; CAA: 0.25%
Temperate Japonica  767 70.80% 4.70% 9.65% 0.00% CAA: 14.60%; C: 0.26%
Tropical Japonica  504 39.10% 21.60% 1.98% 0.00% CAA: 37.10%; C: 0.20%
Japonica Intermediate  241 59.80% 25.30% 5.81% 0.00% CAA: 8.71%; C: 0.41%
VI/Aromatic  96 57.30% 1.00% 2.08% 0.00% C: 37.50%; CAA: 2.08%
Intermediate  90 66.70% 13.30% 1.11% 0.00% CAA: 13.33%; C: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006914384 CA -> C LOC_Os10g12410.1 upstream_gene_variant ; 2796.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> C LOC_Os10g12400-LOC_Os10g12410 intergenic_region ; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> CAA LOC_Os10g12410.1 upstream_gene_variant ; 2795.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> CAA LOC_Os10g12400-LOC_Os10g12410 intergenic_region ; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> AA LOC_Os10g12410.1 upstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> AA LOC_Os10g12400-LOC_Os10g12410 intergenic_region ; MODIFIER silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N
vg1006914384 CA -> DEL N N silent_mutation Average:61.966; most accessible tissue: Minghui63 flower, score: 73.972 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006914384 CA AA -0.01 -0.02 -0.02 -0.01 -0.01 -0.01
vg1006914384 CA C -0.02 -0.03 -0.04 -0.03 -0.03 -0.04
vg1006914384 CA CAA -0.03 -0.04 -0.05 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006914384 NA 1.21E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1006914384 NA 2.47E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 7.54E-06 NA mr1108 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 7.24E-08 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 2.41E-07 1.26E-11 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 3.76E-08 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 4.97E-08 2.15E-11 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 2.38E-11 NA mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 3.15E-09 4.05E-13 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 5.48E-06 NA mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 4.85E-07 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.68E-06 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 9.83E-11 1.16E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 6.23E-07 NA mr1119 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.50E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 7.86E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 2.73E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 2.94E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 2.22E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.26E-07 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 2.09E-09 9.72E-13 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.42E-10 1.43E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 2.67E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 3.03E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.05E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.25E-06 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 3.03E-08 7.10E-17 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.81E-08 1.11E-14 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.17E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 3.32E-07 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 7.81E-07 2.43E-08 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 4.46E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.06E-07 4.93E-14 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 8.52E-08 9.59E-15 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.91E-06 3.97E-11 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 6.79E-10 3.46E-22 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 9.80E-07 3.65E-11 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 9.93E-08 3.05E-14 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 6.69E-06 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 1.76E-06 4.96E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 5.29E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 9.64E-08 8.50E-14 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 5.68E-08 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 5.34E-08 7.30E-10 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 4.07E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 2.54E-10 3.64E-25 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 8.44E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 7.12E-06 8.84E-22 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 6.27E-06 1.68E-16 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 9.86E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 1.57E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006914384 NA 2.80E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251