\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006883184:

Variant ID: vg1006883184 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6883184
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGAGTTCTTTTGGACTTGTAAGAAGGCTCCTCTGGTGCCCCCTAGTTTGTGCTCTACGGCTTCCAGTTCAGCTTGCACCGTATTGTGTGGATTAGTCC[C/T]
GGATTGCGGTTCTATGATTGCTCAATTTGACAAGTCGGAGTCCAAGAGGCTTCGGATCGTGCTCACCCTCACCACTTGGTCGCATCCAACCTTGGCAGGT

Reverse complement sequence

ACCTGCCAAGGTTGGATGCGACCAAGTGGTGAGGGTGAGCACGATCCGAAGCCTCTTGGACTCCGACTTGTCAAATTGAGCAATCATAGAACCGCAATCC[G/A]
GGACTAATCCACACAATACGGTGCAAGCTGAACTGGAAGCCGTAGAGCACAAACTAGGGGGCACCAGAGGAGCCTTCTTACAAGTCCAAAAGAACTCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 49.90% 0.30% 0.00% NA
All Indica  2759 26.90% 72.70% 0.40% 0.00% NA
All Japonica  1512 96.50% 3.40% 0.13% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 2.00% 98.00% 0.00% 0.00% NA
Indica II  465 24.30% 75.30% 0.43% 0.00% NA
Indica III  913 47.20% 52.00% 0.77% 0.00% NA
Indica Intermediate  786 23.80% 76.00% 0.25% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 6.90% 0.20% 0.00% NA
Japonica Intermediate  241 95.90% 3.70% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006883184 C -> T LOC_Os10g12354.1 downstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:54.84; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1006883184 C -> T LOC_Os10g12354.2 downstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:54.84; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N
vg1006883184 C -> T LOC_Os10g12354-LOC_Os10g12380 intergenic_region ; MODIFIER silent_mutation Average:54.84; most accessible tissue: Zhenshan97 young leaf, score: 78.044 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006883184 NA 7.92E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 2.24E-06 1.30E-10 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 7.07E-07 5.57E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 3.64E-07 3.40E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.38E-22 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 4.21E-11 4.96E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 8.90E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 4.27E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.94E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 3.07E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.26E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 8.09E-07 1.36E-10 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.69E-34 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 6.51E-12 8.26E-24 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 5.08E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.29E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 7.60E-06 1.63E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.85E-20 mr1842 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.96E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.37E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 5.77E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.50E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 1.92E-06 6.16E-12 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 1.25E-06 1.22E-12 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 7.27E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 4.77E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 8.88E-10 1.44E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.20E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 1.09E-06 3.85E-13 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.43E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 6.14E-06 3.75E-11 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 7.00E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 1.00E-06 1.15E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 2.23E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 5.25E-07 7.29E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 2.18E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.04E-34 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 1.17E-10 8.64E-23 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 6.22E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 1.86E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 9.31E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 4.71E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 3.87E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006883184 NA 3.43E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251