\
| Variant ID: vg1006880582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6880582 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.03, others allele: 0.00, population size: 113. )
ATTTGTGTGTGACGTGAATATGTGATGTATTTGTGATGAATTTCGTAGAACTTGTGATGTAATTTCTTTTTTAAGATTTTGTGATGTATTTAGAGATGAT[C/T]
GATTTGAGGATTTGGAGGAGATAATCGATTTGGGATTTCATGATTCGGGGATGGGGGATGAAGTGAAATCAATATATTAAAAACAATAAAAAAATAAAGG
CCTTTATTTTTTTATTGTTTTTAATATATTGATTTCACTTCATCCCCCATCCCCGAATCATGAAATCCCAAATCGATTATCTCCTCCAAATCCTCAAATC[G/A]
ATCATCTCTAAATACATCACAAAATCTTAAAAAAGAAATTACATCACAAGTTCTACGAAATTCATCACAAATACATCACATATTCACGTCACACACAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 42.40% | 0.21% | 7.09% | NA |
| All Indica | 2759 | 27.40% | 70.00% | 0.22% | 2.39% | NA |
| All Japonica | 1512 | 96.80% | 3.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 1.50% | 0.70% | 1.49% | 96.28% | NA |
| Indica I | 595 | 2.00% | 96.30% | 0.17% | 1.51% | NA |
| Indica II | 465 | 24.90% | 74.00% | 0.43% | 0.65% | NA |
| Indica III | 913 | 48.20% | 49.70% | 0.11% | 1.97% | NA |
| Indica Intermediate | 786 | 24.00% | 71.10% | 0.25% | 4.58% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 28.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006880582 | C -> T | LOC_Os10g12354.1 | downstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:35.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1006880582 | C -> T | LOC_Os10g12354.2 | downstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:35.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1006880582 | C -> T | LOC_Os10g12354-LOC_Os10g12380 | intergenic_region ; MODIFIER | silent_mutation | Average:35.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1006880582 | C -> DEL | N | N | silent_mutation | Average:35.933; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006880582 | NA | 2.70E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 3.01E-07 | 1.90E-11 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 9.14E-08 | 5.41E-11 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.05E-07 | 1.56E-11 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.86E-23 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 4.50E-11 | 6.18E-22 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.67E-08 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 9.89E-06 | 1.10E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 2.18E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.02E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 2.03E-14 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 9.23E-08 | 2.22E-11 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.57E-36 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 7.96E-12 | 7.21E-25 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 2.59E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 3.94E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 5.36E-06 | 3.26E-11 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 6.37E-19 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.79E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 2.32E-07 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 5.78E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.73E-06 | 3.02E-12 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 5.50E-07 | 3.61E-13 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 7.55E-06 | 3.05E-10 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.03E-23 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 4.37E-10 | 1.03E-21 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.44E-09 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.12E-06 | 1.54E-13 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 7.79E-28 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.80E-07 | NA | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 8.31E-07 | 4.96E-12 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 2.51E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.62E-06 | 9.77E-13 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.81E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 4.65E-07 | 4.33E-09 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 6.21E-29 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 8.02E-06 | 1.94E-36 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 1.13E-11 | 1.96E-24 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.51E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 4.29E-07 | 6.29E-08 | mr1750_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 7.12E-15 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | 5.28E-06 | 2.68E-15 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 1.57E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 8.14E-17 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006880582 | NA | 4.44E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |