\
| Variant ID: vg1006789704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6789704 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTTTGTGATGAACAACACCATTAATTTTAAAAACATAAGGTGCACTTCCATTGTTTATCGTTCTATCGATAGTTGCACCCATAGAGGTGAAAGCAAACA[T/C]
AGAGTTGTAAGATCGCACCTGCCTAAGAAATCTCTTTGAACGTGCATCTCCATTAAATTTCAACAATGTTTTAAGAGGTTCTGGAGGTTCACGTAGTTTT
AAAACTACGTGAACCTCCAGAACCTCTTAAAACATTGTTGAAATTTAATGGAGATGCACGTTCAAAGAGATTTCTTAGGCAGGTGCGATCTTACAACTCT[A/G]
TGTTTGCTTTCACCTCTATGGGTGCAACTATCGATAGAACGATAAACAATGGAAGTGCACCTTATGTTTTTAAAATTAATGGTGTTGTTCATCACAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 5.80% | 0.30% | 8.10% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 63.60% | 10.60% | 0.66% | 25.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.10% | 0.30% | 0.13% | 8.47% | NA |
| Tropical Japonica | 504 | 21.20% | 28.20% | 1.59% | 49.01% | NA |
| Japonica Intermediate | 241 | 64.30% | 7.10% | 0.41% | 28.22% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 15.60% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006789704 | T -> C | LOC_Os10g12174.1 | missense_variant ; p.Met313Val; MODERATE | nonsynonymous_codon ; M313V | Average:7.143; most accessible tissue: Callus, score: 29.028 | benign |
0.662 |
DELETERIOUS | 0.01 |
| vg1006789704 | T -> DEL | LOC_Os10g12174.1 | N | frameshift_variant | Average:7.143; most accessible tissue: Callus, score: 29.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006789704 | NA | 4.69E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 7.98E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | 4.65E-07 | NA | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 3.56E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | 9.57E-06 | 9.57E-06 | mr1173 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 7.36E-11 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 8.31E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 2.11E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 4.96E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 7.92E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | 4.25E-06 | 4.25E-06 | mr1333_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006789704 | NA | 7.57E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |