\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006757388:

Variant ID: vg1006757388 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6757388
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, T: 0.44, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACTTATCGTCTTCACTGCCGGTCGTCTCGTCTGCTGCTGACTAGTGCCCTCGCCTCTACGTCTGGTTTATACCACTACCACTACTGATGGACATCAT[C/T]
GTCTTCCGTCGCCGACTGGTTATGCCGCCGCCGACTGGTGCTTTTATCTTCACAACTGCGCGTCTTAACCACCGGTTTGCTTCTGTTGCTGCCGACTCAT

Reverse complement sequence

ATGAGTCGGCAGCAACAGAAGCAAACCGGTGGTTAAGACGCGCAGTTGTGAAGATAAAAGCACCAGTCGGCGGCGGCATAACCAGTCGGCGACGGAAGAC[G/A]
ATGATGTCCATCAGTAGTGGTAGTGGTATAAACCAGACGTAGAGGCGAGGGCACTAGTCAGCAGCAGACGAGACGACCGGCAGTGAAGACGATAAGTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.50% 19.10% 3.34% 50.00% NA
All Indica  2759 36.60% 4.20% 4.31% 54.87% NA
All Japonica  1512 11.40% 50.40% 1.52% 36.71% NA
Aus  269 0.70% 1.10% 2.97% 95.17% NA
Indica I  595 87.70% 1.00% 1.18% 10.08% NA
Indica II  465 17.60% 3.40% 5.16% 73.76% NA
Indica III  913 16.30% 5.90% 5.37% 72.40% NA
Indica Intermediate  786 32.70% 5.10% 4.96% 57.25% NA
Temperate Japonica  767 1.00% 74.30% 1.04% 23.60% NA
Tropical Japonica  504 29.20% 11.70% 2.58% 56.55% NA
Japonica Intermediate  241 7.10% 55.20% 0.83% 36.93% NA
VI/Aromatic  96 91.70% 2.10% 1.04% 5.21% NA
Intermediate  90 32.20% 23.30% 7.78% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006757388 C -> T LOC_Os10g12140.1 downstream_gene_variant ; 3331.0bp to feature; MODIFIER silent_mutation Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1006757388 C -> T LOC_Os10g12149.1 downstream_gene_variant ; 2459.0bp to feature; MODIFIER silent_mutation Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1006757388 C -> T LOC_Os10g12140-LOC_Os10g12149 intergenic_region ; MODIFIER silent_mutation Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N
vg1006757388 C -> DEL N N silent_mutation Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006757388 NA 3.82E-07 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 5.21E-06 5.66E-09 mr1047 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 1.20E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 3.32E-07 3.32E-07 mr1189 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 4.73E-06 7.48E-10 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 1.34E-10 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 1.07E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 5.56E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 4.16E-06 5.57E-08 mr1625 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 1.51E-06 4.02E-10 mr1642 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 6.41E-06 mr1686 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 6.37E-07 6.37E-07 mr1722 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 7.47E-07 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 3.84E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 6.03E-06 6.02E-06 mr1782 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 4.42E-07 4.42E-07 mr1796 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 4.36E-06 4.36E-06 mr1815 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 5.92E-06 mr1892 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 8.08E-06 1.16E-07 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 4.04E-09 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 9.72E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 1.58E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 5.01E-06 NA mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 9.76E-07 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 5.25E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006757388 NA 1.52E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251