| Variant ID: vg1006757388 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6757388 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.57, T: 0.44, others allele: 0.00, population size: 86. )
TGGACTTATCGTCTTCACTGCCGGTCGTCTCGTCTGCTGCTGACTAGTGCCCTCGCCTCTACGTCTGGTTTATACCACTACCACTACTGATGGACATCAT[C/T]
GTCTTCCGTCGCCGACTGGTTATGCCGCCGCCGACTGGTGCTTTTATCTTCACAACTGCGCGTCTTAACCACCGGTTTGCTTCTGTTGCTGCCGACTCAT
ATGAGTCGGCAGCAACAGAAGCAAACCGGTGGTTAAGACGCGCAGTTGTGAAGATAAAAGCACCAGTCGGCGGCGGCATAACCAGTCGGCGACGGAAGAC[G/A]
ATGATGTCCATCAGTAGTGGTAGTGGTATAAACCAGACGTAGAGGCGAGGGCACTAGTCAGCAGCAGACGAGACGACCGGCAGTGAAGACGATAAGTCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 19.10% | 3.34% | 50.00% | NA |
| All Indica | 2759 | 36.60% | 4.20% | 4.31% | 54.87% | NA |
| All Japonica | 1512 | 11.40% | 50.40% | 1.52% | 36.71% | NA |
| Aus | 269 | 0.70% | 1.10% | 2.97% | 95.17% | NA |
| Indica I | 595 | 87.70% | 1.00% | 1.18% | 10.08% | NA |
| Indica II | 465 | 17.60% | 3.40% | 5.16% | 73.76% | NA |
| Indica III | 913 | 16.30% | 5.90% | 5.37% | 72.40% | NA |
| Indica Intermediate | 786 | 32.70% | 5.10% | 4.96% | 57.25% | NA |
| Temperate Japonica | 767 | 1.00% | 74.30% | 1.04% | 23.60% | NA |
| Tropical Japonica | 504 | 29.20% | 11.70% | 2.58% | 56.55% | NA |
| Japonica Intermediate | 241 | 7.10% | 55.20% | 0.83% | 36.93% | NA |
| VI/Aromatic | 96 | 91.70% | 2.10% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 32.20% | 23.30% | 7.78% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006757388 | C -> T | LOC_Os10g12140.1 | downstream_gene_variant ; 3331.0bp to feature; MODIFIER | silent_mutation | Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg1006757388 | C -> T | LOC_Os10g12149.1 | downstream_gene_variant ; 2459.0bp to feature; MODIFIER | silent_mutation | Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg1006757388 | C -> T | LOC_Os10g12140-LOC_Os10g12149 | intergenic_region ; MODIFIER | silent_mutation | Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| vg1006757388 | C -> DEL | N | N | silent_mutation | Average:23.156; most accessible tissue: Zhenshan97 flag leaf, score: 56.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006757388 | NA | 3.82E-07 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | 5.21E-06 | 5.66E-09 | mr1047 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | NA | 1.20E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | 3.32E-07 | 3.32E-07 | mr1189 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | 4.73E-06 | 7.48E-10 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | NA | 1.34E-10 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | NA | 1.07E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | NA | 5.56E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | 4.16E-06 | 5.57E-08 | mr1625 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006757388 | 1.51E-06 | 4.02E-10 | mr1642 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/