\
| Variant ID: vg1006743994 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6743994 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAGGCATCACAAAATGGTGTTTTTATTTTTTTTTTTGAGAATTACACAGTACAACGCAGACACTCACAATGCACGCGCACTCACCCCTATGAACACACG[C/T]
ACGCAAACCCTACCCCTATGAGCATCTTCGAAGACTGGGCCGGTAAATCCTGGAGAGATTGACGAAGTCACCACAGGCGCCTCGCTGTCGACGGGTACGT
ACGTACCCGTCGACAGCGAGGCGCCTGTGGTGACTTCGTCAATCTCTCCAGGATTTACCGGCCCAGTCTTCGAAGATGCTCATAGGGGTAGGGTTTGCGT[G/A]
CGTGTGTTCATAGGGGTGAGTGCGCGTGCATTGTGAGTGTCTGCGTTGTACTGTGTAATTCTCAAAAAAAAAAATAAAAACACCATTTTGTGATGCCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 4.80% | 8.13% | 32.27% | NA |
| All Indica | 2759 | 57.30% | 0.30% | 8.63% | 33.85% | NA |
| All Japonica | 1512 | 56.40% | 10.60% | 7.28% | 25.73% | NA |
| Aus | 269 | 24.90% | 0.40% | 10.41% | 64.31% | NA |
| Indica I | 595 | 92.80% | 0.00% | 1.18% | 6.05% | NA |
| Indica II | 465 | 37.80% | 0.00% | 6.02% | 56.13% | NA |
| Indica III | 913 | 45.30% | 0.20% | 16.54% | 37.90% | NA |
| Indica Intermediate | 786 | 55.70% | 0.60% | 6.62% | 37.02% | NA |
| Temperate Japonica | 767 | 77.30% | 0.30% | 3.39% | 19.04% | NA |
| Tropical Japonica | 504 | 21.00% | 28.60% | 13.49% | 36.90% | NA |
| Japonica Intermediate | 241 | 63.90% | 5.80% | 6.64% | 23.65% | NA |
| VI/Aromatic | 96 | 45.80% | 50.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 51.10% | 12.20% | 8.89% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006743994 | C -> T | LOC_Os10g12130.1 | upstream_gene_variant ; 3896.0bp to feature; MODIFIER | silent_mutation | Average:67.141; most accessible tissue: Zhenshan97 panicle, score: 89.846 | N | N | N | N |
| vg1006743994 | C -> T | LOC_Os10g12130-LOC_Os10g12140 | intergenic_region ; MODIFIER | silent_mutation | Average:67.141; most accessible tissue: Zhenshan97 panicle, score: 89.846 | N | N | N | N |
| vg1006743994 | C -> DEL | N | N | silent_mutation | Average:67.141; most accessible tissue: Zhenshan97 panicle, score: 89.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006743994 | 2.24E-06 | NA | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 7.53E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 2.56E-11 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 7.45E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 2.99E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 3.88E-07 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | 1.69E-06 | 1.69E-06 | mr1333_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 3.81E-07 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | 8.48E-06 | NA | mr1480_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | 4.69E-06 | NA | mr1482_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | 1.24E-06 | NA | mr1482_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 1.97E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 1.31E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | NA | 9.80E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006743994 | 6.50E-06 | NA | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |