\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006743978:

Variant ID: vg1006743978 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6743978
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAACAGACATCGCAGGAGGCATCACAAAATGGTGTTTTTATTTTTTTTTTTGAGAATTACACAGTACAACGCAGACACTCACAATGCACGCGCACTCA[C/A]
CCCTATGAACACACGCACGCAAACCCTACCCCTATGAGCATCTTCGAAGACTGGGCCGGTAAATCCTGGAGAGATTGACGAAGTCACCACAGGCGCCTCG

Reverse complement sequence

CGAGGCGCCTGTGGTGACTTCGTCAATCTCTCCAGGATTTACCGGCCCAGTCTTCGAAGATGCTCATAGGGGTAGGGTTTGCGTGCGTGTGTTCATAGGG[G/T]
TGAGTGCGCGTGCATTGTGAGTGTCTGCGTTGTACTGTGTAATTCTCAAAAAAAAAAATAAAAACACCATTTTGTGATGCCTCCTGCGATGTCTGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 4.80% 11.40% 33.98% NA
All Indica  2759 49.70% 0.30% 13.56% 36.43% NA
All Japonica  1512 56.10% 10.50% 7.41% 25.99% NA
Aus  269 17.10% 0.40% 16.36% 66.17% NA
Indica I  595 90.80% 0.00% 2.86% 6.39% NA
Indica II  465 28.40% 0.00% 15.05% 56.56% NA
Indica III  913 35.70% 0.30% 21.25% 42.72% NA
Indica Intermediate  786 47.60% 0.60% 11.83% 39.95% NA
Temperate Japonica  767 77.20% 0.30% 3.39% 19.17% NA
Tropical Japonica  504 20.20% 28.40% 13.89% 37.50% NA
Japonica Intermediate  241 63.90% 5.80% 6.64% 23.65% NA
VI/Aromatic  96 45.80% 50.00% 0.00% 4.17% NA
Intermediate  90 48.90% 12.20% 10.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006743978 C -> A LOC_Os10g12130.1 upstream_gene_variant ; 3880.0bp to feature; MODIFIER silent_mutation Average:65.421; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg1006743978 C -> A LOC_Os10g12130-LOC_Os10g12140 intergenic_region ; MODIFIER silent_mutation Average:65.421; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg1006743978 C -> DEL N N silent_mutation Average:65.421; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006743978 8.21E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 1.68E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 3.19E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 9.85E-11 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 1.42E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 1.35E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 1.12E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 3.93E-06 3.93E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 1.49E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 5.56E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 8.27E-07 NA mr1482_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 7.00E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 2.23E-06 9.06E-09 mr1653_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 5.09E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 2.23E-07 NA mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 2.96E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 NA 6.48E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 1.44E-06 1.44E-06 mr1852_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006743978 5.76E-06 NA mr1960_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251