| Variant ID: vg1006727798 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6727798 |
| Reference Allele: C | Alternative Allele: G,A |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 227. )
TAATTCATCTTTAAAGGACAAGCACCCATCATTATATTCTGTAGTTAGAAGGAAAACTGCTCAGTTGCAAGTGTTATGAGTACTGTTCCGCTTAATGTCT[C/G,A]
TTTTAGGAGAGCATTAGTTGGTCAGAACTTGATTAAATGGCACAATTTGTGCGCTTCAATTGTGCATGTTAACTTAATAGAGGAGAATGATTTATTTAGA
TCTAAATAAATCATTCTCCTCTATTAAGTTAACATGCACAATTGAAGCGCACAAATTGTGCCATTTAATCAAGTTCTGACCAACTAATGCTCTCCTAAAA[G/C,T]
AGACATTAAGCGGAACAGTACTCATAACACTTGCAACTGAGCAGTTTTCCTTCTAACTACAGAATATAATGATGGGTGCTTGTCCTTTAAAGATGAATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.60% | 0.32% | 0.13% | A: 0.55% |
| All Indica | 2759 | 99.70% | 0.20% | 0.00% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 89.80% | 7.10% | 0.99% | 0.40% | A: 1.65% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.00% | 0.00% | A: 0.13% |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.60% | 18.50% | 2.78% | 1.19% | A: 4.96% |
| Japonica Intermediate | 241 | 94.20% | 5.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006727798 | C -> G | LOC_Os10g12120.1 | upstream_gene_variant ; 2109.0bp to feature; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> G | LOC_Os10g12130.1 | downstream_gene_variant ; 4864.0bp to feature; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> G | LOC_Os10g12110.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> A | LOC_Os10g12120.1 | upstream_gene_variant ; 2109.0bp to feature; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> A | LOC_Os10g12130.1 | downstream_gene_variant ; 4864.0bp to feature; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> A | LOC_Os10g12110.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| vg1006727798 | C -> DEL | N | N | silent_mutation | Average:26.0; most accessible tissue: Callus, score: 38.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006727798 | NA | 7.98E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | 6.77E-07 | NA | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 3.56E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | 9.57E-06 | 9.57E-06 | mr1173 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 3.30E-11 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 4.42E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 2.11E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 1.81E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 7.92E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | 4.25E-06 | 4.25E-06 | mr1333_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006727798 | NA | 7.57E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |