\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006725677:

Variant ID: vg1006725677 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6725677
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGGAAGGTTATAGTTAACAAGCAGAACTGGCCATGTACTGTGATTGACTTCTCAAATCACCAAATAGATTAATGTTGTCCGTACACATGGCGAAAC[A/G]
CATGTTTCTTGGGTCCTTTGAGAATTCCTGGTAAATCCTATTGATTGTCCTCCACCGTACTGAATCTACTGGGTGCCTCAACATAATATCGACTTTCCGT

Reverse complement sequence

ACGGAAAGTCGATATTATGTTGAGGCACCCAGTAGATTCAGTACGGTGGAGGACAATCAATAGGATTTACCAGGAATTCTCAAAGGACCCAAGAAACATG[T/C]
GTTTCGCCATGTGTACGGACAACATTAATCTATTTGGTGATTTGAGAAGTCAATCACAGTACATGGCCAGTTCTGCTTGTTAACTATAACCTTCCTCCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 12.90% 11.79% 20.93% NA
All Indica  2759 40.60% 17.30% 15.91% 26.24% NA
All Japonica  1512 68.50% 8.30% 7.28% 16.01% NA
Aus  269 98.10% 0.40% 0.37% 1.12% NA
Indica I  595 89.40% 1.70% 3.36% 5.55% NA
Indica II  465 18.90% 17.00% 20.43% 43.66% NA
Indica III  913 19.60% 30.90% 22.67% 26.83% NA
Indica Intermediate  786 40.70% 13.50% 14.89% 30.92% NA
Temperate Japonica  767 89.60% 1.30% 2.35% 6.78% NA
Tropical Japonica  504 39.10% 17.90% 15.08% 27.98% NA
Japonica Intermediate  241 62.70% 10.40% 6.64% 20.33% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 62.20% 10.00% 7.78% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006725677 A -> G LOC_Os10g12090.1 upstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:23.477; most accessible tissue: Callus, score: 53.218 N N N N
vg1006725677 A -> G LOC_Os10g12120.1 upstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:23.477; most accessible tissue: Callus, score: 53.218 N N N N
vg1006725677 A -> G LOC_Os10g12110.1 intron_variant ; MODIFIER silent_mutation Average:23.477; most accessible tissue: Callus, score: 53.218 N N N N
vg1006725677 A -> DEL N N silent_mutation Average:23.477; most accessible tissue: Callus, score: 53.218 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006725677 3.23E-06 2.84E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 1.94E-07 6.73E-10 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 4.01E-06 5.22E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 9.42E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 3.82E-09 6.50E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.76E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 7.48E-06 2.44E-14 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 9.34E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 5.66E-07 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 7.11E-08 2.96E-24 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.42E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 4.43E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 9.75E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.23E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 8.68E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.97E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.68E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 7.03E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 3.17E-08 2.25E-24 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 7.81E-06 1.36E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.39E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 2.30E-06 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 1.42E-07 1.42E-16 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.48E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 4.78E-06 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 5.89E-08 1.27E-27 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.41E-08 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 5.55E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 1.65E-06 7.39E-23 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 1.28E-06 7.01E-20 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 2.77E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 1.73E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006725677 NA 9.85E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251