Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006722269:

Variant ID: vg1006722269 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6722269
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GCGTAGGTGCACACGAGTGAGGGCTAGCCAAAAAATAAAATTTATTTATTTTTGGAATATACTCATCTGTGACGGGCATTAACTCTAGCATAAGTTAATG[C/A,T]
CCGTCACAGATGACTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGAGATAGGTC

Reverse complement sequence

GACCTATCTCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGAGTCATCTGTGACGG[G/T,A]
CATTAACTTATGCTAGAGTTAATGCCCGTCACAGATGAGTATATTCCAAAAATAAATAAATTTTATTTTTTGGCTAGCCCTCACTCGTGTGCACCTACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	4.70%	0.38%	44.90%	NA
All Indica	2759	41.10%	0.30%	0.14%	58.50%	NA
All Japonica	1512	57.90%	10.40%	0.73%	30.95%	NA
Aus	269	97.80%	0.40%	0.00%	1.86%	NA
Indica I	595	89.60%	0.00%	0.00%	10.42%	NA
Indica II	465	22.40%	0.00%	0.00%	77.63%	NA
Indica III	913	19.90%	0.20%	0.00%	79.85%	NA
Indica Intermediate	786	39.90%	0.80%	0.51%	58.78%	NA
Temperate Japonica	767	89.40%	0.30%	0.39%	9.91%	NA
Tropical Japonica	504	10.90%	28.00%	1.19%	59.92%	NA
Japonica Intermediate	241	56.00%	5.80%	0.83%	37.34%	NA
VI/Aromatic	96	46.90%	50.00%	1.04%	2.08%	NA
Intermediate	90	50.00%	11.10%	2.22%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006722269	C -> T	LOC_Os10g12090.1	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	silent_mutation	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> T	LOC_Os10g12110.1	downstream_gene_variant ; 2964.0bp to feature; MODIFIER	silent_mutation	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> T	LOC_Os10g12090-LOC_Os10g12110	intergenic_region ; MODIFIER	silent_mutation	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> A	LOC_Os10g12090.1	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	N	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> A	LOC_Os10g12110.1	downstream_gene_variant ; 2964.0bp to feature; MODIFIER	N	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> A	LOC_Os10g12090-LOC_Os10g12110	intergenic_region ; MODIFIER	N	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg1006722269	C -> DEL	N	N	silent_mutation	Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006722269	NA	8.56E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	5.65E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	1.32E-06	NA	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	1.30E-08	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	4.50E-06	4.49E-06	mr1173	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	2.27E-06	NA	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	8.90E-07	1.37E-08	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	8.55E-12	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	2.48E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	5.41E-07	4.69E-11	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	5.33E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	7.31E-06	NA	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	5.59E-07	7.25E-11	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	2.46E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269	NA	8.55E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251