\
| Variant ID: vg1006722269 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6722269 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
GCGTAGGTGCACACGAGTGAGGGCTAGCCAAAAAATAAAATTTATTTATTTTTGGAATATACTCATCTGTGACGGGCATTAACTCTAGCATAAGTTAATG[C/A,T]
CCGTCACAGATGACTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGAGATAGGTC
GACCTATCTCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGAGTCATCTGTGACGG[G/T,A]
CATTAACTTATGCTAGAGTTAATGCCCGTCACAGATGAGTATATTCCAAAAATAAATAAATTTTATTTTTTGGCTAGCCCTCACTCGTGTGCACCTACGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 4.70% | 0.38% | 44.90% | NA |
| All Indica | 2759 | 41.10% | 0.30% | 0.14% | 58.50% | NA |
| All Japonica | 1512 | 57.90% | 10.40% | 0.73% | 30.95% | NA |
| Aus | 269 | 97.80% | 0.40% | 0.00% | 1.86% | NA |
| Indica I | 595 | 89.60% | 0.00% | 0.00% | 10.42% | NA |
| Indica II | 465 | 22.40% | 0.00% | 0.00% | 77.63% | NA |
| Indica III | 913 | 19.90% | 0.20% | 0.00% | 79.85% | NA |
| Indica Intermediate | 786 | 39.90% | 0.80% | 0.51% | 58.78% | NA |
| Temperate Japonica | 767 | 89.40% | 0.30% | 0.39% | 9.91% | NA |
| Tropical Japonica | 504 | 10.90% | 28.00% | 1.19% | 59.92% | NA |
| Japonica Intermediate | 241 | 56.00% | 5.80% | 0.83% | 37.34% | NA |
| VI/Aromatic | 96 | 46.90% | 50.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 11.10% | 2.22% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006722269 | C -> T | LOC_Os10g12090.1 | upstream_gene_variant ; 1001.0bp to feature; MODIFIER | silent_mutation | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> T | LOC_Os10g12110.1 | downstream_gene_variant ; 2964.0bp to feature; MODIFIER | silent_mutation | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> T | LOC_Os10g12090-LOC_Os10g12110 | intergenic_region ; MODIFIER | silent_mutation | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> A | LOC_Os10g12090.1 | upstream_gene_variant ; 1001.0bp to feature; MODIFIER | N | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> A | LOC_Os10g12110.1 | downstream_gene_variant ; 2964.0bp to feature; MODIFIER | N | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> A | LOC_Os10g12090-LOC_Os10g12110 | intergenic_region ; MODIFIER | N | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1006722269 | C -> DEL | N | N | silent_mutation | Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006722269 | NA | 8.56E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 5.65E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 1.32E-06 | NA | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 1.30E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 4.50E-06 | 4.49E-06 | mr1173 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 2.27E-06 | NA | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 8.90E-07 | 1.37E-08 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 8.55E-12 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 2.48E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 5.41E-07 | 4.69E-11 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 5.33E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 7.31E-06 | NA | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | 5.59E-07 | 7.25E-11 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 2.46E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006722269 | NA | 8.55E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |