\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006722269:

Variant ID: vg1006722269 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6722269
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTAGGTGCACACGAGTGAGGGCTAGCCAAAAAATAAAATTTATTTATTTTTGGAATATACTCATCTGTGACGGGCATTAACTCTAGCATAAGTTAATG[C/A,T]
CCGTCACAGATGACTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGAGATAGGTC

Reverse complement sequence

GACCTATCTCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGAGTCATCTGTGACGG[G/T,A]
CATTAACTTATGCTAGAGTTAATGCCCGTCACAGATGAGTATATTCCAAAAATAAATAAATTTTATTTTTTGGCTAGCCCTCACTCGTGTGCACCTACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 4.70% 0.38% 44.90% NA
All Indica  2759 41.10% 0.30% 0.14% 58.50% NA
All Japonica  1512 57.90% 10.40% 0.73% 30.95% NA
Aus  269 97.80% 0.40% 0.00% 1.86% NA
Indica I  595 89.60% 0.00% 0.00% 10.42% NA
Indica II  465 22.40% 0.00% 0.00% 77.63% NA
Indica III  913 19.90% 0.20% 0.00% 79.85% NA
Indica Intermediate  786 39.90% 0.80% 0.51% 58.78% NA
Temperate Japonica  767 89.40% 0.30% 0.39% 9.91% NA
Tropical Japonica  504 10.90% 28.00% 1.19% 59.92% NA
Japonica Intermediate  241 56.00% 5.80% 0.83% 37.34% NA
VI/Aromatic  96 46.90% 50.00% 1.04% 2.08% NA
Intermediate  90 50.00% 11.10% 2.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006722269 C -> T LOC_Os10g12090.1 upstream_gene_variant ; 1001.0bp to feature; MODIFIER silent_mutation Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> T LOC_Os10g12110.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> T LOC_Os10g12090-LOC_Os10g12110 intergenic_region ; MODIFIER silent_mutation Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> A LOC_Os10g12090.1 upstream_gene_variant ; 1001.0bp to feature; MODIFIER N Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> A LOC_Os10g12110.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER N Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> A LOC_Os10g12090-LOC_Os10g12110 intergenic_region ; MODIFIER N Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg1006722269 C -> DEL N N silent_mutation Average:43.275; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006722269 NA 8.56E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 5.65E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 1.32E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 1.30E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 4.50E-06 4.49E-06 mr1173 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 2.27E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 8.90E-07 1.37E-08 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 8.55E-12 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 2.48E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 5.41E-07 4.69E-11 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 5.33E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 7.31E-06 NA mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 5.59E-07 7.25E-11 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 2.46E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006722269 NA 8.55E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251