\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006715361:

Variant ID: vg1006715361 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6715361
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGTTTAGTCCCACATCAGTAAGTGATGATGGGAGAGCACGAATTAAAAGGTGAGGGCAGTCCTCATCCATCAGACTAGTCTTTTGGGCTGCGTAGAC[C/T]
CATGACTTCAAGTTGTGGCTCCGGTTGAGTCTGTGGTAGAGGATGCCCAAAGTAACCTTGGTGACCCACGGTTGGTTGACTGGGCTGCGCACTCTAATAA

Reverse complement sequence

TTATTAGAGTGCGCAGCCCAGTCAACCAACCGTGGGTCACCAAGGTTACTTTGGGCATCCTCTACCACAGACTCAACCGGAGCCACAACTTGAAGTCATG[G/A]
GTCTACGCAGCCCAAAAGACTAGTCTGATGGATGAGGACTGCCCTCACCTTTTAATTCGTGCTCTCCCATCATCACTTACTGATGTGGGACTAAACCCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 44.00% 0.11% 2.56% NA
All Indica  2759 62.80% 37.10% 0.07% 0.00% NA
All Japonica  1512 25.60% 66.30% 0.20% 7.87% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 89.70% 10.30% 0.00% 0.00% NA
Indica II  465 39.60% 60.40% 0.00% 0.00% NA
Indica III  913 61.70% 38.20% 0.11% 0.00% NA
Indica Intermediate  786 57.60% 42.20% 0.13% 0.00% NA
Temperate Japonica  767 5.70% 79.50% 0.26% 14.47% NA
Tropical Japonica  504 52.00% 47.80% 0.00% 0.20% NA
Japonica Intermediate  241 33.60% 63.10% 0.41% 2.90% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006715361 C -> T LOC_Os10g12080.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:67.034; most accessible tissue: Minghui63 root, score: 89.995 N N N N
vg1006715361 C -> T LOC_Os10g12050-LOC_Os10g12080 intergenic_region ; MODIFIER silent_mutation Average:67.034; most accessible tissue: Minghui63 root, score: 89.995 N N N N
vg1006715361 C -> DEL N N silent_mutation Average:67.034; most accessible tissue: Minghui63 root, score: 89.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006715361 C T -0.05 -0.03 -0.03 -0.06 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006715361 NA 2.20E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 3.98E-09 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 8.28E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 1.97E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 5.50E-09 NA mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 8.88E-07 6.18E-10 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 3.46E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 4.30E-11 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 1.10E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 1.72E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 1.64E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 3.15E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361 NA 6.43E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251