Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006715361:

Variant ID: vg1006715361 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6715361
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGGTTTAGTCCCACATCAGTAAGTGATGATGGGAGAGCACGAATTAAAAGGTGAGGGCAGTCCTCATCCATCAGACTAGTCTTTTGGGCTGCGTAGAC[C/T]
CATGACTTCAAGTTGTGGCTCCGGTTGAGTCTGTGGTAGAGGATGCCCAAAGTAACCTTGGTGACCCACGGTTGGTTGACTGGGCTGCGCACTCTAATAA

Reverse complement sequence

TTATTAGAGTGCGCAGCCCAGTCAACCAACCGTGGGTCACCAAGGTTACTTTGGGCATCCTCTACCACAGACTCAACCGGAGCCACAACTTGAAGTCATG[G/A]
GTCTACGCAGCCCAAAAGACTAGTCTGATGGATGAGGACTGCCCTCACCTTTTAATTCGTGCTCTCCCATCATCACTTACTGATGTGGGACTAAACCCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.30%	44.00%	0.11%	2.56%	NA
All Indica	2759	62.80%	37.10%	0.07%	0.00%	NA
All Japonica	1512	25.60%	66.30%	0.20%	7.87%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	89.70%	10.30%	0.00%	0.00%	NA
Indica II	465	39.60%	60.40%	0.00%	0.00%	NA
Indica III	913	61.70%	38.20%	0.11%	0.00%	NA
Indica Intermediate	786	57.60%	42.20%	0.13%	0.00%	NA
Temperate Japonica	767	5.70%	79.50%	0.26%	14.47%	NA
Tropical Japonica	504	52.00%	47.80%	0.00%	0.20%	NA
Japonica Intermediate	241	33.60%	63.10%	0.41%	2.90%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	48.90%	48.90%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006715361	C -> T	LOC_Os10g12080.1	upstream_gene_variant ; 245.0bp to feature; MODIFIER	silent_mutation	Average:67.034; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N
vg1006715361	C -> T	LOC_Os10g12050-LOC_Os10g12080	intergenic_region ; MODIFIER	silent_mutation	Average:67.034; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N
vg1006715361	C -> DEL	N	N	silent_mutation	Average:67.034; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1006715361	C	T	-0.05	-0.03	-0.03	-0.06	-0.04	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006715361	NA	2.20E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	3.98E-09	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	8.28E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	1.97E-11	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	5.50E-09	NA	mr1027_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	8.88E-07	6.18E-10	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	3.46E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	4.30E-11	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	1.10E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	1.72E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	1.64E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	3.15E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006715361	NA	6.43E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251