\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006687337:

Variant ID: vg1006687337 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6687337
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAAAGGCTCTCGTCTTGACGGGACGGGGCGAGGCGTGCGTCAGACCACCAGTCGCCACCTAACCGTTGATCCGACCGGTCTGTGACTGGTCACAGACC[G/A]
GATAAAAGAGCGCGCTGCATGCAACGTGACACGCTTGACCAGACCGCAATAAATGCGGTTAGGTGAGCCCTACCGTGTTCACCCAACCTATGTACATAGT

Reverse complement sequence

ACTATGTACATAGGTTGGGTGAACACGGTAGGGCTCACCTAACCGCATTTATTGCGGTCTGGTCAAGCGTGTCACGTTGCATGCAGCGCGCTCTTTTATC[C/T]
GGTCTGTGACCAGTCACAGACCGGTCGGATCAACGGTTAGGTGGCGACTGGTGGTCTGACGCACGCCTCGCCCCGTCCCGTCAAGACGAGAGCCTTTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.80% 0.10% 1.50% 78.57% NA
All Indica  2759 7.00% 0.20% 1.63% 91.16% NA
All Japonica  1512 45.00% 0.00% 1.19% 53.84% NA
Aus  269 0.40% 0.00% 0.00% 99.63% NA
Indica I  595 3.50% 0.30% 0.67% 95.46% NA
Indica II  465 8.20% 0.40% 1.29% 90.11% NA
Indica III  913 9.30% 0.20% 2.63% 87.84% NA
Indica Intermediate  786 6.20% 0.00% 1.40% 92.37% NA
Temperate Japonica  767 65.80% 0.00% 0.91% 33.25% NA
Tropical Japonica  504 9.10% 0.00% 1.39% 89.48% NA
Japonica Intermediate  241 53.50% 0.00% 1.66% 44.81% NA
VI/Aromatic  96 32.30% 0.00% 6.25% 61.46% NA
Intermediate  90 34.40% 0.00% 2.22% 63.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006687337 G -> A LOC_Os10g12030.1 upstream_gene_variant ; 844.0bp to feature; MODIFIER silent_mutation Average:13.096; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1006687337 G -> A LOC_Os10g12030-LOC_Os10g12050 intergenic_region ; MODIFIER silent_mutation Average:13.096; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1006687337 G -> DEL N N silent_mutation Average:13.096; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006687337 NA 2.42E-36 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 1.08E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 6.83E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 1.62E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 7.54E-35 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 7.85E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 9.30E-07 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 8.96E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 4.02E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 3.52E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 3.67E-07 6.95E-18 mr1913 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 6.83E-06 NA mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 2.03E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 2.37E-15 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 2.33E-14 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 4.22E-41 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 3.35E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 8.27E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 6.75E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 1.90E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006687337 NA 4.06E-15 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251