Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006619818:

Variant ID: vg1006619818 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6619818
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGAAATGGGGAAAGTGGCGAGAGTCTCGGCGGGGAAGAAAGCGACGCTTTGACTTCAGCGTTTATTTCGCCAGGGTATCGGGAGTGCTAATGGGCCTG[A/G]
GCCTATACAGTACTTCAGCCCAATTCTATTATCAGTGTGGTTAGTTGTGATCCTTAGGGACTTAGGCATTGTTGCTTTGGCAATTTTTTCTCACAACAGT

Reverse complement sequence

ACTGTTGTGAGAAAAAATTGCCAAAGCAACAATGCCTAAGTCCCTAAGGATCACAACTAACCACACTGATAATAGAATTGGGCTGAAGTACTGTATAGGC[T/C]
CAGGCCCATTAGCACTCCCGATACCCTGGCGAAATAAACGCTGAAGTCAAAGCGTCGCTTTCTTCCCCGCCGAGACTCTCGCCACTTTCCCCATTTCACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.40%	20.30%	4.89%	52.35%	NA
All Indica	2759	36.60%	2.80%	5.07%	55.56%	NA
All Japonica	1512	1.10%	56.40%	0.07%	42.46%	NA
Aus	269	4.50%	1.50%	30.48%	63.57%	NA
Indica I	595	10.30%	6.70%	6.55%	76.47%	NA
Indica II	465	60.20%	1.70%	0.86%	37.20%	NA
Indica III	913	36.50%	1.00%	8.00%	54.55%	NA
Indica Intermediate	786	42.60%	2.50%	3.05%	51.78%	NA
Temperate Japonica	767	0.50%	88.80%	0.00%	10.69%	NA
Tropical Japonica	504	0.60%	8.10%	0.20%	91.07%	NA
Japonica Intermediate	241	3.70%	54.40%	0.00%	41.91%	NA
VI/Aromatic	96	3.10%	6.20%	3.12%	87.50%	NA
Intermediate	90	22.20%	23.30%	5.56%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006619818	A -> G	LOC_Os10g11930.1	upstream_gene_variant ; 329.0bp to feature; MODIFIER	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N
vg1006619818	A -> G	LOC_Os10g11940.1	upstream_gene_variant ; 2644.0bp to feature; MODIFIER	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N
vg1006619818	A -> G	LOC_Os10g11954.1	upstream_gene_variant ; 4213.0bp to feature; MODIFIER	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N
vg1006619818	A -> G	LOC_Os10g11920.1	downstream_gene_variant ; 3760.0bp to feature; MODIFIER	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N
vg1006619818	A -> G	LOC_Os10g11930-LOC_Os10g11940	intergenic_region ; MODIFIER	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N
vg1006619818	A -> DEL	N	N	silent_mutation	Average:13.923; most accessible tissue: Callus, score: 55.774	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006619818	8.14E-09	8.14E-09	mr1349	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251