\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006602460:

Variant ID: vg1006602460 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6602460
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.06, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTATACAAAGTTAAGGCATTGCTTGCTATCTAGAACCTGTATTTTTACTTGTCAAATCAATAATTTCAAATTGATGTCACGAAGCCAATTCTGTATGG[T/C]
GGAATTGGCAAGAGAGCATATACGTCAATTAAATATGTTTTGTTTCTGTTAACGACCAAATTTGGTAAATCATAGATTGGATTTGGAGTCAAAGCCTAAG

Reverse complement sequence

CTTAGGCTTTGACTCCAAATCCAATCTATGATTTACCAAATTTGGTCGTTAACAGAAACAAAACATATTTAATTGACGTATATGCTCTCTTGCCAATTCC[A/G]
CCATACAGAATTGGCTTCGTGACATCAATTTGAAATTATTGATTTGACAAGTAAAAATACAGGTTCTAGATAGCAAGCAATGCCTTAACTTTGTATAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.00% 19.80% 0.32% 57.83% NA
All Indica  2759 36.40% 1.70% 0.43% 61.47% NA
All Japonica  1512 0.90% 56.90% 0.13% 42.13% NA
Aus  269 1.10% 0.00% 0.37% 98.51% NA
Indica I  595 10.30% 2.50% 0.84% 86.39% NA
Indica II  465 60.40% 1.10% 0.43% 38.06% NA
Indica III  913 36.60% 1.10% 0.11% 62.21% NA
Indica Intermediate  786 41.70% 2.20% 0.51% 55.60% NA
Temperate Japonica  767 0.40% 88.80% 0.00% 10.82% NA
Tropical Japonica  504 0.40% 9.10% 0.40% 90.08% NA
Japonica Intermediate  241 3.30% 55.20% 0.00% 41.49% NA
VI/Aromatic  96 3.10% 7.30% 0.00% 89.58% NA
Intermediate  90 20.00% 25.60% 0.00% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006602460 T -> C LOC_Os10g11889.1 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:16.14; most accessible tissue: Callus, score: 76.493 N N N N
vg1006602460 T -> C LOC_Os10g11910.1 upstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:16.14; most accessible tissue: Callus, score: 76.493 N N N N
vg1006602460 T -> C LOC_Os10g11889.2 upstream_gene_variant ; 2900.0bp to feature; MODIFIER silent_mutation Average:16.14; most accessible tissue: Callus, score: 76.493 N N N N
vg1006602460 T -> C LOC_Os10g11889-LOC_Os10g11910 intergenic_region ; MODIFIER silent_mutation Average:16.14; most accessible tissue: Callus, score: 76.493 N N N N
vg1006602460 T -> DEL N N silent_mutation Average:16.14; most accessible tissue: Callus, score: 76.493 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006602460 NA 2.18E-12 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 1.25E-11 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 2.62E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 2.99E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 7.41E-07 mr1057_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 9.26E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 2.60E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 4.16E-06 4.14E-06 mr1387_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 4.79E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 7.13E-06 1.19E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 5.40E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 3.54E-06 mr1660_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 1.03E-10 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 2.93E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 7.07E-06 1.64E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460 NA 8.53E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251