Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006602460:

Variant ID: vg1006602460 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6602460
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.06, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTATACAAAGTTAAGGCATTGCTTGCTATCTAGAACCTGTATTTTTACTTGTCAAATCAATAATTTCAAATTGATGTCACGAAGCCAATTCTGTATGG[T/C]
GGAATTGGCAAGAGAGCATATACGTCAATTAAATATGTTTTGTTTCTGTTAACGACCAAATTTGGTAAATCATAGATTGGATTTGGAGTCAAAGCCTAAG

Reverse complement sequence

CTTAGGCTTTGACTCCAAATCCAATCTATGATTTACCAAATTTGGTCGTTAACAGAAACAAAACATATTTAATTGACGTATATGCTCTCTTGCCAATTCC[A/G]
CCATACAGAATTGGCTTCGTGACATCAATTTGAAATTATTGATTTGACAAGTAAAAATACAGGTTCTAGATAGCAAGCAATGCCTTAACTTTGTATAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.00%	19.80%	0.32%	57.83%	NA
All Indica	2759	36.40%	1.70%	0.43%	61.47%	NA
All Japonica	1512	0.90%	56.90%	0.13%	42.13%	NA
Aus	269	1.10%	0.00%	0.37%	98.51%	NA
Indica I	595	10.30%	2.50%	0.84%	86.39%	NA
Indica II	465	60.40%	1.10%	0.43%	38.06%	NA
Indica III	913	36.60%	1.10%	0.11%	62.21%	NA
Indica Intermediate	786	41.70%	2.20%	0.51%	55.60%	NA
Temperate Japonica	767	0.40%	88.80%	0.00%	10.82%	NA
Tropical Japonica	504	0.40%	9.10%	0.40%	90.08%	NA
Japonica Intermediate	241	3.30%	55.20%	0.00%	41.49%	NA
VI/Aromatic	96	3.10%	7.30%	0.00%	89.58%	NA
Intermediate	90	20.00%	25.60%	0.00%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006602460	T -> C	LOC_Os10g11889.1	upstream_gene_variant ; 2903.0bp to feature; MODIFIER	silent_mutation	Average:16.14; most accessible tissue: Callus, score: 76.493	N	N	N	N
vg1006602460	T -> C	LOC_Os10g11910.1	upstream_gene_variant ; 4755.0bp to feature; MODIFIER	silent_mutation	Average:16.14; most accessible tissue: Callus, score: 76.493	N	N	N	N
vg1006602460	T -> C	LOC_Os10g11889.2	upstream_gene_variant ; 2900.0bp to feature; MODIFIER	silent_mutation	Average:16.14; most accessible tissue: Callus, score: 76.493	N	N	N	N
vg1006602460	T -> C	LOC_Os10g11889-LOC_Os10g11910	intergenic_region ; MODIFIER	silent_mutation	Average:16.14; most accessible tissue: Callus, score: 76.493	N	N	N	N
vg1006602460	T -> DEL	N	N	silent_mutation	Average:16.14; most accessible tissue: Callus, score: 76.493	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006602460	NA	2.18E-12	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	1.25E-11	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	2.62E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	2.99E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	7.41E-07	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	9.26E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	2.60E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	4.16E-06	4.14E-06	mr1387_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	4.79E-06	mr1551_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	7.13E-06	1.19E-07	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	5.40E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	3.54E-06	mr1660_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	1.03E-10	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	2.93E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	7.07E-06	1.64E-07	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006602460	NA	8.53E-09	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251