\
| Variant ID: vg1006596224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6596224 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )
GGCCCCGCAGAAAAGTGGCTTCTCAGTGAGCCGTTAATTGGATCCATGCTACTACAAATATGCCAGTTTAGATAAATACCACTGCTATTCACGATATCAG[C/T]
TACGTGCCACTAGAATTTGGGGAAACTAGAACCGTACCGTCCCGTTGCGTTTTCCGTTAAAAATCTCCGTTAGCCTCAATTGCACGTGAGGAAGAAAGAA
TTCTTTCTTCCTCACGTGCAATTGAGGCTAACGGAGATTTTTAACGGAAAACGCAACGGGACGGTACGGTTCTAGTTTCCCCAAATTCTAGTGGCACGTA[G/A]
CTGATATCGTGAATAGCAGTGGTATTTATCTAAACTGGCATATTTGTAGTAGCATGGATCCAATTAACGGCTCACTGAGAAGCCACTTTTCTGCGGGGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.00% | 19.30% | 27.38% | 31.23% | NA |
| All Indica | 2759 | 36.30% | 1.00% | 34.22% | 28.49% | NA |
| All Japonica | 1512 | 0.90% | 56.80% | 12.37% | 29.89% | NA |
| Aus | 269 | 1.50% | 0.70% | 32.34% | 65.43% | NA |
| Indica I | 595 | 9.90% | 1.00% | 35.13% | 53.95% | NA |
| Indica II | 465 | 60.20% | 0.40% | 21.29% | 18.06% | NA |
| Indica III | 913 | 36.60% | 0.90% | 46.22% | 16.32% | NA |
| Indica Intermediate | 786 | 41.90% | 1.40% | 27.23% | 29.52% | NA |
| Temperate Japonica | 767 | 0.40% | 88.80% | 1.43% | 9.39% | NA |
| Tropical Japonica | 504 | 0.60% | 9.10% | 31.15% | 59.13% | NA |
| Japonica Intermediate | 241 | 3.30% | 54.80% | 7.88% | 34.02% | NA |
| VI/Aromatic | 96 | 3.10% | 5.20% | 50.00% | 41.67% | NA |
| Intermediate | 90 | 21.10% | 23.30% | 31.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006596224 | C -> T | LOC_Os10g11889.1 | downstream_gene_variant ; 829.0bp to feature; MODIFIER | silent_mutation | Average:36.44; most accessible tissue: Callus, score: 62.317 | N | N | N | N |
| vg1006596224 | C -> T | LOC_Os10g11889.2 | downstream_gene_variant ; 829.0bp to feature; MODIFIER | silent_mutation | Average:36.44; most accessible tissue: Callus, score: 62.317 | N | N | N | N |
| vg1006596224 | C -> T | LOC_Os10g11870-LOC_Os10g11889 | intergenic_region ; MODIFIER | silent_mutation | Average:36.44; most accessible tissue: Callus, score: 62.317 | N | N | N | N |
| vg1006596224 | C -> DEL | N | N | silent_mutation | Average:36.44; most accessible tissue: Callus, score: 62.317 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006596224 | NA | 5.15E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | 6.85E-06 | NA | mr1128 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 7.35E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 6.68E-08 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 3.59E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 1.76E-07 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 3.36E-06 | mr1817 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 3.72E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 8.80E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006596224 | NA | 1.01E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |