\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006596224:

Variant ID: vg1006596224 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6596224
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCCCGCAGAAAAGTGGCTTCTCAGTGAGCCGTTAATTGGATCCATGCTACTACAAATATGCCAGTTTAGATAAATACCACTGCTATTCACGATATCAG[C/T]
TACGTGCCACTAGAATTTGGGGAAACTAGAACCGTACCGTCCCGTTGCGTTTTCCGTTAAAAATCTCCGTTAGCCTCAATTGCACGTGAGGAAGAAAGAA

Reverse complement sequence

TTCTTTCTTCCTCACGTGCAATTGAGGCTAACGGAGATTTTTAACGGAAAACGCAACGGGACGGTACGGTTCTAGTTTCCCCAAATTCTAGTGGCACGTA[G/A]
CTGATATCGTGAATAGCAGTGGTATTTATCTAAACTGGCATATTTGTAGTAGCATGGATCCAATTAACGGCTCACTGAGAAGCCACTTTTCTGCGGGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.00% 19.30% 27.38% 31.23% NA
All Indica  2759 36.30% 1.00% 34.22% 28.49% NA
All Japonica  1512 0.90% 56.80% 12.37% 29.89% NA
Aus  269 1.50% 0.70% 32.34% 65.43% NA
Indica I  595 9.90% 1.00% 35.13% 53.95% NA
Indica II  465 60.20% 0.40% 21.29% 18.06% NA
Indica III  913 36.60% 0.90% 46.22% 16.32% NA
Indica Intermediate  786 41.90% 1.40% 27.23% 29.52% NA
Temperate Japonica  767 0.40% 88.80% 1.43% 9.39% NA
Tropical Japonica  504 0.60% 9.10% 31.15% 59.13% NA
Japonica Intermediate  241 3.30% 54.80% 7.88% 34.02% NA
VI/Aromatic  96 3.10% 5.20% 50.00% 41.67% NA
Intermediate  90 21.10% 23.30% 31.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006596224 C -> T LOC_Os10g11889.1 downstream_gene_variant ; 829.0bp to feature; MODIFIER silent_mutation Average:36.44; most accessible tissue: Callus, score: 62.317 N N N N
vg1006596224 C -> T LOC_Os10g11889.2 downstream_gene_variant ; 829.0bp to feature; MODIFIER silent_mutation Average:36.44; most accessible tissue: Callus, score: 62.317 N N N N
vg1006596224 C -> T LOC_Os10g11870-LOC_Os10g11889 intergenic_region ; MODIFIER silent_mutation Average:36.44; most accessible tissue: Callus, score: 62.317 N N N N
vg1006596224 C -> DEL N N silent_mutation Average:36.44; most accessible tissue: Callus, score: 62.317 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006596224 NA 5.15E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 6.85E-06 NA mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 7.35E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 6.68E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 3.59E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 1.76E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 3.36E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 3.72E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 8.80E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224 NA 1.01E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251