Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1006596224:

Variant ID: vg1006596224 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6596224
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCCCGCAGAAAAGTGGCTTCTCAGTGAGCCGTTAATTGGATCCATGCTACTACAAATATGCCAGTTTAGATAAATACCACTGCTATTCACGATATCAG[C/T]
TACGTGCCACTAGAATTTGGGGAAACTAGAACCGTACCGTCCCGTTGCGTTTTCCGTTAAAAATCTCCGTTAGCCTCAATTGCACGTGAGGAAGAAAGAA

Reverse complement sequence

TTCTTTCTTCCTCACGTGCAATTGAGGCTAACGGAGATTTTTAACGGAAAACGCAACGGGACGGTACGGTTCTAGTTTCCCCAAATTCTAGTGGCACGTA[G/A]
CTGATATCGTGAATAGCAGTGGTATTTATCTAAACTGGCATATTTGTAGTAGCATGGATCCAATTAACGGCTCACTGAGAAGCCACTTTTCTGCGGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.00%	19.30%	27.38%	31.23%	NA
All Indica	2759	36.30%	1.00%	34.22%	28.49%	NA
All Japonica	1512	0.90%	56.80%	12.37%	29.89%	NA
Aus	269	1.50%	0.70%	32.34%	65.43%	NA
Indica I	595	9.90%	1.00%	35.13%	53.95%	NA
Indica II	465	60.20%	0.40%	21.29%	18.06%	NA
Indica III	913	36.60%	0.90%	46.22%	16.32%	NA
Indica Intermediate	786	41.90%	1.40%	27.23%	29.52%	NA
Temperate Japonica	767	0.40%	88.80%	1.43%	9.39%	NA
Tropical Japonica	504	0.60%	9.10%	31.15%	59.13%	NA
Japonica Intermediate	241	3.30%	54.80%	7.88%	34.02%	NA
VI/Aromatic	96	3.10%	5.20%	50.00%	41.67%	NA
Intermediate	90	21.10%	23.30%	31.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006596224	C -> T	LOC_Os10g11889.1	downstream_gene_variant ; 829.0bp to feature; MODIFIER	silent_mutation	Average:36.44; most accessible tissue: Callus, score: 62.317	N	N	N	N
vg1006596224	C -> T	LOC_Os10g11889.2	downstream_gene_variant ; 829.0bp to feature; MODIFIER	silent_mutation	Average:36.44; most accessible tissue: Callus, score: 62.317	N	N	N	N
vg1006596224	C -> T	LOC_Os10g11870-LOC_Os10g11889	intergenic_region ; MODIFIER	silent_mutation	Average:36.44; most accessible tissue: Callus, score: 62.317	N	N	N	N
vg1006596224	C -> DEL	N	N	silent_mutation	Average:36.44; most accessible tissue: Callus, score: 62.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006596224	NA	5.15E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	6.85E-06	NA	mr1128	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	7.35E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	6.68E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	3.59E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	1.76E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	3.36E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	3.72E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	8.80E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006596224	NA	1.01E-07	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251