\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006590352:

Variant ID: vg1006590352 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6590352
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.02, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTGTTTTCCTCAAGTAAAGTTCAAACTTCTACCATGGAGATCCCCTTGGTCCTCTGATGCTTGCCTTGTTGATGACCTACAATATTTCATTGTAAAC[T/A]
GCCTCAAAATTTAATATTCAGAGAGTGCTATATTCACTGCCACTTGTACACCCTGGAAAATTCTAAATATCAATATCAAAATGATCCAAATACCTTGGTT

Reverse complement sequence

AACCAAGGTATTTGGATCATTTTGATATTGATATTTAGAATTTTCCAGGGTGTACAAGTGGCAGTGAATATAGCACTCTCTGAATATTAAATTTTGAGGC[A/T]
GTTTACAATGAAATATTGTAGGTCATCAACAAGGCAAGCATCAGAGGACCAAGGGGATCTCCATGGTAGAAGTTTGAACTTTACTTGAGGAAAACAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 15.80% 2.18% 18.01% NA
All Indica  2759 75.00% 0.60% 0.14% 24.28% NA
All Japonica  1512 35.70% 47.10% 6.42% 10.78% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 83.40% 0.70% 0.00% 15.97% NA
Indica II  465 83.90% 0.20% 0.22% 15.70% NA
Indica III  913 65.30% 0.50% 0.22% 33.95% NA
Indica Intermediate  786 74.70% 0.80% 0.13% 24.43% NA
Temperate Japonica  767 9.40% 72.40% 11.47% 6.78% NA
Tropical Japonica  504 79.00% 7.30% 0.60% 13.10% NA
Japonica Intermediate  241 29.00% 49.80% 2.49% 18.67% NA
VI/Aromatic  96 93.80% 5.20% 0.00% 1.04% NA
Intermediate  90 70.00% 15.60% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006590352 T -> A LOC_Os10g11870.1 upstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:31.656; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg1006590352 T -> A LOC_Os10g11870-LOC_Os10g11889 intergenic_region ; MODIFIER silent_mutation Average:31.656; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg1006590352 T -> DEL N N silent_mutation Average:31.656; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006590352 NA 6.14E-14 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 8.08E-16 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 3.04E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.53E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 3.27E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 3.42E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 7.98E-14 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 4.49E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 5.33E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 4.18E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 1.31E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.30E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.36E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 3.56E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 9.49E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.45E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 9.76E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 7.34E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.10E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 1.45E-18 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 4.31E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 2.49E-16 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 1.03E-16 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006590352 NA 8.79E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251