Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006498976:

Variant ID: vg1006498976 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6498976
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTTTAAAATGGCAAATTTTCCTTTAGAAAATAGCGACTTCGTAATTTTAACTGTAAAACACCACACGGACTCACTTTGACAAAAACACTCTCTGAAT[G/A]
TGGTTATTTGGGAACAGGCTCCTCTGACTTTACGGAGCCACGTCACGCCGTAACGTAACCAATCGCGATCCACCGTACAGGGCGATCCAAGGATGCTCCG

Reverse complement sequence

CGGAGCATCCTTGGATCGCCCTGTACGGTGGATCGCGATTGGTTACGTTACGGCGTGACGTGGCTCCGTAAAGTCAGAGGAGCCTGTTCCCAAATAACCA[C/T]
ATTCAGAGAGTGTTTTTGTCAAAGTGAGTCCGTGTGGTGTTTTACAGTTAAAATTACGAAGTCGCTATTTTCTAAAGGAAAATTTGCCATTTTAAAAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 21.60% 0.30% 0.00% NA
All Indica  2759 64.80% 34.70% 0.47% 0.00% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 13.30% 86.60% 0.17% 0.00% NA
Indica II  465 83.40% 15.90% 0.65% 0.00% NA
Indica III  913 85.00% 14.80% 0.22% 0.00% NA
Indica Intermediate  786 69.50% 29.60% 0.89% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006498976 G -> A LOC_Os10g11740.1 upstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:43.264; most accessible tissue: Callus, score: 74.34 N N N N
vg1006498976 G -> A LOC_Os10g11750.1 intron_variant ; MODIFIER silent_mutation Average:43.264; most accessible tissue: Callus, score: 74.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006498976 1.79E-09 1.84E-41 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 1.06E-09 8.05E-23 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.70E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 3.92E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.67E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 2.78E-07 2.49E-19 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 1.65E-10 3.54E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 9.84E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 4.80E-09 9.75E-39 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 1.66E-09 2.41E-21 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 8.24E-10 5.32E-27 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 1.04E-12 6.06E-30 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 2.47E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 2.04E-06 mr1789 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 7.54E-06 3.13E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.77E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 6.25E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.70E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.23E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 8.03E-08 7.11E-24 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 1.16E-13 1.03E-31 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.88E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.55E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 6.68E-12 2.83E-43 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 9.21E-11 4.15E-24 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 7.71E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.32E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 8.95E-10 2.53E-34 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 7.63E-13 4.56E-34 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.81E-11 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.08E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 7.10E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 4.49E-06 3.49E-17 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 4.53E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 2.28E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.88E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 2.80E-12 mr1936_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006498976 NA 1.35E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251