\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006489415:

Variant ID: vg1006489415 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 6489415
Reference Allele: AAlternative Allele: AGGTGTTGGTTT,T,AGGTGTTGGTT,AGATGTTGGTTT,AGGTGTTGGTTG
Primary Allele: ASecondary Allele: AGGTGTTGGTTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTATTTTTCATTGTGCGGAGGTGGAAAAGGCTTATAGGTGTCGATTTTAATTGAACCGGCACATATAAGACTGGTCTCTACAAGGGTTTTTTATAGTT[A/AGGTGTTGGTTT,T,AGGTGTTGGTT,AGATGTTGGTTT,AGGTGTTGGTTG]
AACCAACACCTATGGGTTTCTTGGGGATGCACCAGTAGCCCGATAGATGCTGGTGCTAGCTAGGCTAGAACTGTTATCTATGATATCACGTAGGTGCGGG

Reverse complement sequence

CCCGCACCTACGTGATATCATAGATAACAGTTCTAGCCTAGCTAGCACCAGCATCTATCGGGCTACTGGTGCATCCCCAAGAAACCCATAGGTGTTGGTT[T/AAACCAACACCT,A,AACCAACACCT,AAACCAACATCT,CAACCAACACCT]
AACTATAAAAAACCCTTGTAGAGACCAGTCTTATATGTGCCGGTTCAATTAAAATCGACACCTATAAGCCTTTTCCACCTCCGCACAATGAAAAATAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AGGTGTTGGTTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 41.10% 5.46% 0.00% T: 3.98%; AGGTGTTGGTT: 0.57%; AGATGTTGGTTT: 0.04%; AGGTGTTGGTTG: 0.02%
All Indica  2759 40.00% 50.20% 4.97% 0.00% T: 4.78%; AGGTGTTGGTT: 0.04%; AGGTGTTGGTTG: 0.04%
All Japonica  1512 58.30% 32.30% 4.56% 0.00% T: 3.04%; AGGTGTTGGTT: 1.72%; AGATGTTGGTTT: 0.13%
Aus  269 98.50% 0.70% 0.37% 0.00% T: 0.37%
Indica I  595 12.30% 78.50% 4.71% 0.00% T: 4.54%
Indica II  465 61.30% 32.90% 4.09% 0.00% T: 1.72%
Indica III  913 40.70% 46.90% 4.60% 0.00% T: 7.67%; AGGTGTTGGTTG: 0.11%
Indica Intermediate  786 47.60% 42.70% 6.11% 0.00% T: 3.44%; AGGTGTTGGTT: 0.13%
Temperate Japonica  767 64.50% 32.50% 1.43% 0.00% T: 1.30%; AGATGTTGGTTT: 0.26%
Tropical Japonica  504 48.80% 32.70% 7.94% 0.00% T: 5.36%; AGGTGTTGGTT: 5.16%
Japonica Intermediate  241 58.10% 30.70% 7.47% 0.00% T: 3.73%
VI/Aromatic  96 8.30% 45.80% 42.71% 0.00% T: 3.12%
Intermediate  90 53.30% 28.90% 11.11% 0.00% T: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006489415 A -> T LOC_Os10g11730.1 downstream_gene_variant ; 2582.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> T LOC_Os10g11740.1 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> T LOC_Os10g11730-LOC_Os10g11740 intergenic_region ; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTG LOC_Os10g11730.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTG LOC_Os10g11740.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTG LOC_Os10g11730-LOC_Os10g11740 intergenic_region ; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGATGTTGGTTT LOC_Os10g11730.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGATGTTGGTTT LOC_Os10g11740.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGATGTTGGTTT LOC_Os10g11730-LOC_Os10g11740 intergenic_region ; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTT LOC_Os10g11730.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTT LOC_Os10g11740.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTTT LOC_Os10g11730-LOC_Os10g11740 intergenic_region ; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTT LOC_Os10g11730.1 downstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTT LOC_Os10g11740.1 downstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg1006489415 A -> AGGTGTTGGTT LOC_Os10g11730-LOC_Os10g11740 intergenic_region ; MODIFIER silent_mutation Average:68.53; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006489415 A AGATG* 0.2 0.1 0.11 0.21 0.2 0.22
vg1006489415 A AGGTG* 0.25 0.13 0.13 0.21 0.21 0.23
vg1006489415 A T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006489415 1.66E-06 2.73E-06 mr1521_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251