\
| Variant ID: vg1006448469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6448469 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )
ATAAAGCATCCAAAGCTCCCTTTTTGGCTCGGTGCACAATGCACGTCTGCACATTTGCCTTTTGCACACGTGACAAAGCGTCGTGTCTGAGGCATGATCA[C/T]
GACCGCTGCAGCGCTACCGCTTTGCTACATGTCAAATCATATATGGAGATAATAAATTTTGTTAATAACATGAAAAGAAAATTAAAGGTGTGATGCAGCG
CGCTGCATCACACCTTTAATTTTCTTTTCATGTTATTAACAAAATTTATTATCTCCATATATGATTTGACATGTAGCAAAGCGGTAGCGCTGCAGCGGTC[G/A]
TGATCATGCCTCAGACACGACGCTTTGTCACGTGTGCAAAAGGCAAATGTGCAGACGTGCATTGTGCACCGAGCCAAAAAGGGAGCTTTGGATGCTTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 22.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 74.60% | 25.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 77.30% | 22.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 54.90% | 45.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.90% | 22.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.50% | 31.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006448469 | C -> T | LOC_Os10g11672.1 | downstream_gene_variant ; 3675.0bp to feature; MODIFIER | silent_mutation | Average:34.697; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1006448469 | C -> T | LOC_Os10g11680.1 | downstream_gene_variant ; 1890.0bp to feature; MODIFIER | silent_mutation | Average:34.697; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1006448469 | C -> T | LOC_Os10g11672-LOC_Os10g11680 | intergenic_region ; MODIFIER | silent_mutation | Average:34.697; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006448469 | NA | 3.77E-08 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1006448469 | NA | 2.41E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.04E-07 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 4.93E-07 | NA | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.47E-07 | NA | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.20E-08 | 4.11E-12 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 5.71E-07 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.45E-10 | 2.04E-12 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 6.68E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.92E-09 | 7.78E-13 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 3.00E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.54E-08 | 6.25E-24 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 8.56E-13 | 1.17E-23 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.11E-06 | 3.45E-10 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 6.62E-06 | NA | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.75E-06 | 2.52E-08 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 4.09E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 3.39E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 5.00E-09 | 1.54E-14 | mr1183 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.40E-08 | 4.04E-11 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 9.44E-07 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.27E-09 | 1.81E-12 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.29E-09 | 5.29E-28 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.59E-12 | 4.94E-27 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.37E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.06E-09 | 2.97E-14 | mr1503 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 1.85E-08 | 2.35E-10 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.37E-09 | 5.69E-16 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 7.74E-08 | 1.82E-13 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 6.49E-07 | 5.18E-08 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.78E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.20E-06 | 4.58E-13 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 2.47E-13 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 8.37E-11 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 7.54E-20 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 5.68E-09 | 6.82E-22 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.33E-10 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.44E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 7.90E-07 | 6.19E-14 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 2.47E-06 | 5.06E-12 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.18E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.21E-12 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 3.91E-10 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 8.79E-07 | 5.71E-09 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 7.16E-08 | 1.43E-26 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 2.07E-09 | 2.59E-24 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 3.23E-08 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.48E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | 4.59E-06 | 2.77E-18 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 1.21E-14 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 9.64E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 4.83E-07 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 2.36E-06 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006448469 | NA | 3.30E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |