\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006382367:

Variant ID: vg1006382367 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6382367
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAACTATTCTTCACATAATAATCTAAGCAAAACCCAACTCTAAACGATGACGGCTACTGAATAAATGTGATTAGGGACGTCCTAGTGTTGCCCTAGGG[T/C]
GCACACCACCTTGGGCTAAGCCCACGACACAATTACGAGGCCCAAAACCCAAATCAGATTGGGACTGGATGAGATATGTGGCTTGTTTTGACGAAAACGC

Reverse complement sequence

GCGTTTTCGTCAAAACAAGCCACATATCTCATCCAGTCCCAATCTGATTTGGGTTTTGGGCCTCGTAATTGTGTCGTGGGCTTAGCCCAAGGTGGTGTGC[A/G]
CCCTAGGGCAACACTAGGACGTCCCTAATCACATTTATTCAGTAGCCGTCATCGTTTAGAGTTGGGTTTTGCTTAGATTATTATGTGAAGAATAGTTTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 34.80% 0.19% 0.19% NA
All Indica  2759 63.60% 35.70% 0.33% 0.33% NA
All Japonica  1512 58.70% 41.30% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 89.60% 10.30% 0.00% 0.17% NA
Indica II  465 40.20% 58.90% 0.86% 0.00% NA
Indica III  913 63.50% 35.70% 0.44% 0.33% NA
Indica Intermediate  786 58.00% 41.20% 0.13% 0.64% NA
Temperate Japonica  767 39.80% 60.20% 0.00% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006382367 T -> C LOC_Os10g11512.1 downstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg1006382367 T -> C LOC_Os10g11520.1 downstream_gene_variant ; 2887.0bp to feature; MODIFIER silent_mutation Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg1006382367 T -> C LOC_Os10g11530.1 downstream_gene_variant ; 4028.0bp to feature; MODIFIER silent_mutation Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg1006382367 T -> C LOC_Os10g11506-LOC_Os10g11512 intergenic_region ; MODIFIER silent_mutation Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N
vg1006382367 T -> DEL N N silent_mutation Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006382367 NA 5.12E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 4.69E-12 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 2.72E-07 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 5.09E-07 NA mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 2.83E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 7.39E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 1.50E-08 mr1379_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 8.01E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 2.00E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 4.70E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 9.98E-11 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 9.27E-09 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382367 NA 5.95E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251