\
| Variant ID: vg1006382367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6382367 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 250. )
CGAAACTATTCTTCACATAATAATCTAAGCAAAACCCAACTCTAAACGATGACGGCTACTGAATAAATGTGATTAGGGACGTCCTAGTGTTGCCCTAGGG[T/C]
GCACACCACCTTGGGCTAAGCCCACGACACAATTACGAGGCCCAAAACCCAAATCAGATTGGGACTGGATGAGATATGTGGCTTGTTTTGACGAAAACGC
GCGTTTTCGTCAAAACAAGCCACATATCTCATCCAGTCCCAATCTGATTTGGGTTTTGGGCCTCGTAATTGTGTCGTGGGCTTAGCCCAAGGTGGTGTGC[A/G]
CCCTAGGGCAACACTAGGACGTCCCTAATCACATTTATTCAGTAGCCGTCATCGTTTAGAGTTGGGTTTTGCTTAGATTATTATGTGAAGAATAGTTTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 34.80% | 0.19% | 0.19% | NA |
| All Indica | 2759 | 63.60% | 35.70% | 0.33% | 0.33% | NA |
| All Japonica | 1512 | 58.70% | 41.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 10.30% | 0.00% | 0.17% | NA |
| Indica II | 465 | 40.20% | 58.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 63.50% | 35.70% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 58.00% | 41.20% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 39.80% | 60.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006382367 | T -> C | LOC_Os10g11512.1 | downstream_gene_variant ; 1390.0bp to feature; MODIFIER | silent_mutation | Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| vg1006382367 | T -> C | LOC_Os10g11520.1 | downstream_gene_variant ; 2887.0bp to feature; MODIFIER | silent_mutation | Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| vg1006382367 | T -> C | LOC_Os10g11530.1 | downstream_gene_variant ; 4028.0bp to feature; MODIFIER | silent_mutation | Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| vg1006382367 | T -> C | LOC_Os10g11506-LOC_Os10g11512 | intergenic_region ; MODIFIER | silent_mutation | Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| vg1006382367 | T -> DEL | N | N | silent_mutation | Average:32.521; most accessible tissue: Zhenshan97 young leaf, score: 51.997 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006382367 | NA | 5.12E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 4.69E-12 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 2.72E-07 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | 5.09E-07 | NA | mr1027_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 2.83E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 7.39E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 1.50E-08 | mr1379_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 8.01E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 2.00E-08 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 4.70E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 9.98E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 9.27E-09 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382367 | NA | 5.95E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |