\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006382038:

Variant ID: vg1006382038 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6382038
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTCTCAGATGCCTTCAACTAAATCTGATACCACTTGATGTGCACTAGGGTTCCCGATCTTCTGAAAGGTTCTGATAAACAACGATTTGGGTGGAGTC[A/G]
CGACACAAATTGATCCGGCTTGTTGAACGTGCACGCTCTTGAGCCCCGCAATCGCAGCACCATGTCTCCTCTGGTTATCAACCGTGCCGAAACCCAGTTG

Reverse complement sequence

CAACTGGGTTTCGGCACGGTTGATAACCAGAGGAGACATGGTGCTGCGATTGCGGGGCTCAAGAGCGTGCACGTTCAACAAGCCGGATCAATTTGTGTCG[T/C]
GACTCCACCCAAATCGTTGTTTATCAGAACCTTTCAGAAGATCGGGAACCCTAGTGCACATCAAGTGGTATCAGATTTAGTTGAAGGCATCTGAGAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.00% 0.13% 0.21% NA
All Indica  2759 61.40% 38.10% 0.14% 0.36% NA
All Japonica  1512 55.00% 44.90% 0.13% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 11.30% 88.60% 0.17% 0.00% NA
Indica II  465 82.20% 17.20% 0.00% 0.65% NA
Indica III  913 82.70% 17.00% 0.11% 0.22% NA
Indica Intermediate  786 62.50% 36.60% 0.25% 0.64% NA
Temperate Japonica  767 32.70% 67.00% 0.26% 0.00% NA
Tropical Japonica  504 90.30% 9.70% 0.00% 0.00% NA
Japonica Intermediate  241 51.90% 48.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006382038 A -> G LOC_Os10g11512.1 downstream_gene_variant ; 1719.0bp to feature; MODIFIER silent_mutation Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg1006382038 A -> G LOC_Os10g11520.1 downstream_gene_variant ; 3216.0bp to feature; MODIFIER silent_mutation Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg1006382038 A -> G LOC_Os10g11530.1 downstream_gene_variant ; 4357.0bp to feature; MODIFIER silent_mutation Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg1006382038 A -> G LOC_Os10g11506-LOC_Os10g11512 intergenic_region ; MODIFIER silent_mutation Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N
vg1006382038 A -> DEL N N silent_mutation Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006382038 1.30E-06 1.06E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 4.09E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.77E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 5.01E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.15E-18 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 1.78E-09 4.86E-20 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 9.89E-07 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 1.59E-06 5.89E-15 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 9.08E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 9.75E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 9.94E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 3.72E-09 2.44E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 9.88E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 3.75E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.70E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 7.56E-06 mr1633 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 5.87E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 4.60E-06 1.32E-13 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 4.65E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 5.34E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.16E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 6.68E-07 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.33E-17 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 1.13E-09 1.12E-24 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.58E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.09E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 3.15E-09 5.21E-17 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.33E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 4.98E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 7.21E-24 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 4.80E-10 1.49E-28 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.62E-09 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.19E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 8.23E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 4.77E-20 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 2.53E-08 7.31E-21 mr1794_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.55E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 1.77E-10 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006382038 NA 2.03E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251