| Variant ID: vg1006382038 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6382038 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 227. )
TTGTTCTCAGATGCCTTCAACTAAATCTGATACCACTTGATGTGCACTAGGGTTCCCGATCTTCTGAAAGGTTCTGATAAACAACGATTTGGGTGGAGTC[A/G]
CGACACAAATTGATCCGGCTTGTTGAACGTGCACGCTCTTGAGCCCCGCAATCGCAGCACCATGTCTCCTCTGGTTATCAACCGTGCCGAAACCCAGTTG
CAACTGGGTTTCGGCACGGTTGATAACCAGAGGAGACATGGTGCTGCGATTGCGGGGCTCAAGAGCGTGCACGTTCAACAAGCCGGATCAATTTGTGTCG[T/C]
GACTCCACCCAAATCGTTGTTTATCAGAACCTTTCAGAAGATCGGGAACCCTAGTGCACATCAAGTGGTATCAGATTTAGTTGAAGGCATCTGAGAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 43.00% | 0.13% | 0.21% | NA |
| All Indica | 2759 | 61.40% | 38.10% | 0.14% | 0.36% | NA |
| All Japonica | 1512 | 55.00% | 44.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 11.30% | 88.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 82.70% | 17.00% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 62.50% | 36.60% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 32.70% | 67.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 48.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 42.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006382038 | A -> G | LOC_Os10g11512.1 | downstream_gene_variant ; 1719.0bp to feature; MODIFIER | silent_mutation | Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| vg1006382038 | A -> G | LOC_Os10g11520.1 | downstream_gene_variant ; 3216.0bp to feature; MODIFIER | silent_mutation | Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| vg1006382038 | A -> G | LOC_Os10g11530.1 | downstream_gene_variant ; 4357.0bp to feature; MODIFIER | silent_mutation | Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| vg1006382038 | A -> G | LOC_Os10g11506-LOC_Os10g11512 | intergenic_region ; MODIFIER | silent_mutation | Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| vg1006382038 | A -> DEL | N | N | silent_mutation | Average:35.15; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006382038 | 1.30E-06 | 1.06E-15 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 4.09E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 2.77E-08 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 5.01E-07 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 2.15E-18 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | 1.78E-09 | 4.86E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 9.89E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | 1.59E-06 | 5.89E-15 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 9.08E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006382038 | NA | 9.75E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/