Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006354247:

Variant ID: vg1006354247 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6354247
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATGTATAGAAAAACCTCTGAGTTATTCCCTGCACCTCATGAATCATGACGGAACTCCTGATCTATAGAAGCATGCAAAATAACATACAAAAGAAAT[A/T]
TGATTAGGTTAACACTAATTAGTTAAACAGTAGCAGGAACTACTTCTAATATAATATGAAGTAATTGTTACTTGCACACATGGCAACACATTGTCCTTGA

Reverse complement sequence

TCAAGGACAATGTGTTGCCATGTGTGCAAGTAACAATTACTTCATATTATATTAGAAGTAGTTCCTGCTACTGTTTAACTAATTAGTGTTAACCTAATCA[T/A]
ATTTCTTTTGTATGTTATTTTGCATGCTTCTATAGATCAGGAGTTCCGTCATGATTCATGAGGTGCAGGGAATAACTCAGAGGTTTTTCTATACATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	12.70%	6.24%	0.00%	NA
All Indica	2759	75.80%	13.60%	10.62%	0.00%	NA
All Japonica	1512	85.80%	14.20%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	98.30%	1.30%	0.34%	0.00%	NA
Indica II	465	77.60%	13.80%	8.60%	0.00%	NA
Indica III	913	57.60%	22.50%	19.93%	0.00%	NA
Indica Intermediate	786	78.80%	12.50%	8.78%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	77.80%	22.20%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	28.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	7.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006354247	A -> T	LOC_Os10g11454.1	upstream_gene_variant ; 4650.0bp to feature; MODIFIER	silent_mutation	Average:11.675; most accessible tissue: Minghui63 flag leaf, score: 19.18	N	N	N	N
vg1006354247	A -> T	LOC_Os10g11454-LOC_Os10g11480	intergenic_region ; MODIFIER	silent_mutation	Average:11.675; most accessible tissue: Minghui63 flag leaf, score: 19.18	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006354247	6.50E-06	3.17E-11	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.41E-10	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	5.19E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.89E-11	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	1.37E-06	7.00E-15	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.79E-08	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	3.48E-07	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.22E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.51E-09	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	2.40E-17	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	2.08E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	3.83E-06	1.94E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	9.31E-06	2.99E-11	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	4.58E-07	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	4.19E-07	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	6.70E-08	1.30E-14	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	9.17E-08	8.01E-16	mr1114_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.10E-10	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	2.18E-15	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	1.43E-06	8.21E-11	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	6.93E-06	1.81E-12	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.13E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	3.30E-06	1.77E-12	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	2.47E-09	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	6.94E-09	6.57E-11	mr1258_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	1.25E-19	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	2.22E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006354247	NA	3.31E-14	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251