\
| Variant ID: vg1006268134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6268134 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTGCGAGAGCGGCAAACCGTACACCCGGTACGTTCCCCGGTCCGCGGTTTTGGAAATTCATTTAGTTCGCAAGCACCGACCCAGGTGTCGGGTTTTCCA[T/A]
GTCTTTTGTAAAACCCAAGTTTTACCCAAGTTGTTATTCAAATTTTTAAGTTTGAAGGCGTCCGTCGGTACTCGCATAGGGTGCACGAATATCGAGACGC
GCGTCTCGATATTCGTGCACCCTATGCGAGTACCGACGGACGCCTTCAAACTTAAAAATTTGAATAACAACTTGGGTAAAACTTGGGTTTTACAAAAGAC[A/T]
TGGAAAACCCGACACCTGGGTCGGTGCTTGCGAACTAAATGAATTTCCAAAACCGCGGACCGGGGAACGTACCGGGTGTACGGTTTGCCGCTCTCGCACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 11.60% | 2.31% | 14.96% | NA |
| All Indica | 2759 | 98.20% | 0.40% | 0.36% | 1.09% | NA |
| All Japonica | 1512 | 16.20% | 34.10% | 5.62% | 44.05% | NA |
| Aus | 269 | 97.40% | 2.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.50% | 0.17% | 0.67% | NA |
| Indica II | 465 | 96.60% | 0.90% | 0.43% | 2.15% | NA |
| Indica III | 913 | 99.60% | 0.00% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 97.10% | 0.50% | 0.64% | 1.78% | NA |
| Temperate Japonica | 767 | 12.80% | 55.40% | 1.17% | 30.64% | NA |
| Tropical Japonica | 504 | 16.90% | 3.20% | 13.10% | 66.87% | NA |
| Japonica Intermediate | 241 | 25.70% | 31.10% | 4.15% | 39.00% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 9.38% | 3.12% | NA |
| Intermediate | 90 | 72.20% | 14.40% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006268134 | T -> A | LOC_Os10g11290.1 | downstream_gene_variant ; 1746.0bp to feature; MODIFIER | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1006268134 | T -> A | LOC_Os10g11310.1 | downstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1006268134 | T -> A | LOC_Os10g11310.2 | downstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1006268134 | T -> A | LOC_Os10g11310.3 | downstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1006268134 | T -> A | LOC_Os10g11290-LOC_Os10g11310 | intergenic_region ; MODIFIER | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| vg1006268134 | T -> DEL | N | N | silent_mutation | Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006268134 | NA | 6.62E-08 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006268134 | 8.65E-06 | 8.65E-06 | mr1781 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006268134 | NA | 1.50E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006268134 | NA | 3.86E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006268134 | 5.91E-08 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006268134 | 3.83E-06 | 3.04E-12 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |