Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006268134:

Variant ID: vg1006268134 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6268134
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTGCGAGAGCGGCAAACCGTACACCCGGTACGTTCCCCGGTCCGCGGTTTTGGAAATTCATTTAGTTCGCAAGCACCGACCCAGGTGTCGGGTTTTCCA[T/A]
GTCTTTTGTAAAACCCAAGTTTTACCCAAGTTGTTATTCAAATTTTTAAGTTTGAAGGCGTCCGTCGGTACTCGCATAGGGTGCACGAATATCGAGACGC

Reverse complement sequence

GCGTCTCGATATTCGTGCACCCTATGCGAGTACCGACGGACGCCTTCAAACTTAAAAATTTGAATAACAACTTGGGTAAAACTTGGGTTTTACAAAAGAC[A/T]
TGGAAAACCCGACACCTGGGTCGGTGCTTGCGAACTAAATGAATTTCCAAAACCGCGGACCGGGGAACGTACCGGGTGTACGGTTTGCCGCTCTCGCACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	11.60%	2.31%	14.96%	NA
All Indica	2759	98.20%	0.40%	0.36%	1.09%	NA
All Japonica	1512	16.20%	34.10%	5.62%	44.05%	NA
Aus	269	97.40%	2.20%	0.37%	0.00%	NA
Indica I	595	98.70%	0.50%	0.17%	0.67%	NA
Indica II	465	96.60%	0.90%	0.43%	2.15%	NA
Indica III	913	99.60%	0.00%	0.22%	0.22%	NA
Indica Intermediate	786	97.10%	0.50%	0.64%	1.78%	NA
Temperate Japonica	767	12.80%	55.40%	1.17%	30.64%	NA
Tropical Japonica	504	16.90%	3.20%	13.10%	66.87%	NA
Japonica Intermediate	241	25.70%	31.10%	4.15%	39.00%	NA
VI/Aromatic	96	87.50%	0.00%	9.38%	3.12%	NA
Intermediate	90	72.20%	14.40%	4.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006268134	T -> A	LOC_Os10g11290.1	downstream_gene_variant ; 1746.0bp to feature; MODIFIER	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg1006268134	T -> A	LOC_Os10g11310.1	downstream_gene_variant ; 4515.0bp to feature; MODIFIER	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg1006268134	T -> A	LOC_Os10g11310.2	downstream_gene_variant ; 4515.0bp to feature; MODIFIER	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg1006268134	T -> A	LOC_Os10g11310.3	downstream_gene_variant ; 4515.0bp to feature; MODIFIER	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg1006268134	T -> A	LOC_Os10g11290-LOC_Os10g11310	intergenic_region ; MODIFIER	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N
vg1006268134	T -> DEL	N	N	silent_mutation	Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006268134	NA	6.62E-08	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134	8.65E-06	8.65E-06	mr1781	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134	NA	1.50E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134	NA	3.86E-10	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134	5.91E-08	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134	3.83E-06	3.04E-12	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251