\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006268134:

Variant ID: vg1006268134 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6268134
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGCGAGAGCGGCAAACCGTACACCCGGTACGTTCCCCGGTCCGCGGTTTTGGAAATTCATTTAGTTCGCAAGCACCGACCCAGGTGTCGGGTTTTCCA[T/A]
GTCTTTTGTAAAACCCAAGTTTTACCCAAGTTGTTATTCAAATTTTTAAGTTTGAAGGCGTCCGTCGGTACTCGCATAGGGTGCACGAATATCGAGACGC

Reverse complement sequence

GCGTCTCGATATTCGTGCACCCTATGCGAGTACCGACGGACGCCTTCAAACTTAAAAATTTGAATAACAACTTGGGTAAAACTTGGGTTTTACAAAAGAC[A/T]
TGGAAAACCCGACACCTGGGTCGGTGCTTGCGAACTAAATGAATTTCCAAAACCGCGGACCGGGGAACGTACCGGGTGTACGGTTTGCCGCTCTCGCACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 11.60% 2.31% 14.96% NA
All Indica  2759 98.20% 0.40% 0.36% 1.09% NA
All Japonica  1512 16.20% 34.10% 5.62% 44.05% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 98.70% 0.50% 0.17% 0.67% NA
Indica II  465 96.60% 0.90% 0.43% 2.15% NA
Indica III  913 99.60% 0.00% 0.22% 0.22% NA
Indica Intermediate  786 97.10% 0.50% 0.64% 1.78% NA
Temperate Japonica  767 12.80% 55.40% 1.17% 30.64% NA
Tropical Japonica  504 16.90% 3.20% 13.10% 66.87% NA
Japonica Intermediate  241 25.70% 31.10% 4.15% 39.00% NA
VI/Aromatic  96 87.50% 0.00% 9.38% 3.12% NA
Intermediate  90 72.20% 14.40% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006268134 T -> A LOC_Os10g11290.1 downstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1006268134 T -> A LOC_Os10g11310.1 downstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1006268134 T -> A LOC_Os10g11310.2 downstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1006268134 T -> A LOC_Os10g11310.3 downstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1006268134 T -> A LOC_Os10g11290-LOC_Os10g11310 intergenic_region ; MODIFIER silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1006268134 T -> DEL N N silent_mutation Average:27.401; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006268134 NA 6.62E-08 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134 8.65E-06 8.65E-06 mr1781 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134 NA 1.50E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134 NA 3.86E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134 5.91E-08 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006268134 3.83E-06 3.04E-12 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251