\
| Variant ID: vg1006264139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6264139 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGGGTGTATTTCACGAAATGAAGTTAAAGTGAGTTATGTAAGATATATGCATGTGGGTATCACATGGCCCAATCAAAGGCTAAATGCCACTTCAGTGAAC[A/G]
GCAAGTGCATTTATATGGGCCATGTCGTGTTCGCCGACAGCATGGTGATGGATGAACAAAAGGTTCGCACAGCGAGGGAGTGACCGATGCCGTGCTCCTT
AAGGAGCACGGCATCGGTCACTCCCTCGCTGTGCGAACCTTTTGTTCATCCATCACCATGCTGTCGGCGAACACGACATGGCCCATATAAATGCACTTGC[T/C]
GTTCACTGAAGTGGCATTTAGCCTTTGATTGGGCCATGTGATACCCACATGCATATATCTTACATAACTCACTTTAACTTCATTTCGTGAAATACACCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.50% | 11.30% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 79.50% | 20.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006264139 | A -> G | LOC_Os10g11280.1 | upstream_gene_variant ; 1205.0bp to feature; MODIFIER | silent_mutation | Average:50.172; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1006264139 | A -> G | LOC_Os10g11290.1 | upstream_gene_variant ; 763.0bp to feature; MODIFIER | silent_mutation | Average:50.172; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1006264139 | A -> G | LOC_Os10g11280-LOC_Os10g11290 | intergenic_region ; MODIFIER | silent_mutation | Average:50.172; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006264139 | 2.65E-07 | NA | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 6.97E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | 7.39E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 1.44E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | 2.65E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 6.50E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | 2.12E-07 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 1.82E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | 7.14E-06 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 5.74E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 9.27E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006264139 | NA | 6.44E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |