\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006251648:

Variant ID: vg1006251648 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6251648
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTGTAATATAGATTACTCTAAGCTGAATTATAATAATCTGACTAAAATAAGCTACGAGTTGTTTGTTTCTCTGGATTATTAGAGGCATCTAAGCTACG[T/A]
GTTGTTTGTTTCTCTGGATTATTAGAGGCATCTAAGGCTAGTGGGTCTTTAGCCACTCAATAATCTGAAAAAAGCTCCTCTAGAGGAGATTATTGGATTA

Reverse complement sequence

TAATCCAATAATCTCCTCTAGAGGAGCTTTTTTCAGATTATTGAGTGGCTAAAGACCCACTAGCCTTAGATGCCTCTAATAATCCAGAGAAACAAACAAC[A/T]
CGTAGCTTAGATGCCTCTAATAATCCAGAGAAACAAACAACTCGTAGCTTATTTTAGTCAGATTATTATAATTCAGCTTAGAGTAATCTATATTACAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 5.40% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 83.90% 16.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 70.40% 29.60% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006251648 T -> A LOC_Os10g11260.1 downstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1006251648 T -> A LOC_Os10g11270.1 downstream_gene_variant ; 412.0bp to feature; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1006251648 T -> A LOC_Os10g11260.2 downstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1006251648 T -> A LOC_Os10g11260.3 downstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1006251648 T -> A LOC_Os10g11260.4 downstream_gene_variant ; 806.0bp to feature; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N
vg1006251648 T -> A LOC_Os10g11260-LOC_Os10g11270 intergenic_region ; MODIFIER silent_mutation Average:48.91; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006251648 NA 6.69E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 7.68E-07 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 3.18E-06 3.18E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 8.82E-11 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 1.05E-06 1.64E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 8.67E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 6.77E-11 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 4.45E-07 1.05E-11 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 4.05E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 8.09E-07 NA mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 1.83E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 4.04E-06 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 4.76E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 7.38E-13 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 6.58E-08 3.29E-12 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 3.70E-07 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 3.72E-09 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 3.92E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 1.43E-06 NA mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 8.81E-08 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 8.44E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 6.87E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 9.37E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 5.65E-07 1.36E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006251648 NA 3.50E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251