\
| Variant ID: vg1006197978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6197978 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )
GCAAGATTGAACTTTTGGCACAACTTCAAGAATGCAACGCCGAGTTGGATATAGAACATAAAAAGCTAGCCGATCTCCCAAAATCTGTTGAAGAGCAGAA[G/A]
GCAAGGCTAAAATCGGCTATCAAGAATGTTGCTGATCTGACCAAGTCTTTAAAAGTTATCCCTGGAACCGATGCTCAAGATGCCCAACCATTGAAGAAGT
ACTTCTTCAATGGTTGGGCATCTTGAGCATCGGTTCCAGGGATAACTTTTAAAGACTTGGTCAGATCAGCAACATTCTTGATAGCCGATTTTAGCCTTGC[C/T]
TTCTGCTCTTCAACAGATTTTGGGAGATCGGCTAGCTTTTTATGTTCTATATCCAACTCGGCGTTGCATTCTTGAAGTTGTGCCAAAAGTTCAATCTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 1.20% | 2.14% | 2.62% | NA |
| All Indica | 2759 | 94.90% | 2.00% | 3.15% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 0.00% | 0.66% | 8.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.50% | 6.70% | 10.76% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 1.50% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 84.50% | 0.00% | 0.65% | 14.86% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 2.07% | 2.90% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006197978 | G -> A | LOC_Os10g11180.1 | synonymous_variant ; p.Lys856Lys; LOW | synonymous_codon | Average:32.972; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| vg1006197978 | G -> DEL | LOC_Os10g11180.1 | N | frameshift_variant | Average:32.972; most accessible tissue: Zhenshan97 young leaf, score: 47.311 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006197978 | 3.92E-08 | 1.45E-09 | mr1053 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 2.92E-09 | 6.59E-12 | mr1070 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 5.86E-06 | 3.46E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 1.20E-12 | 2.15E-14 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 8.51E-06 | NA | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 2.46E-07 | 1.55E-07 | mr1147 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 7.39E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 2.71E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 4.82E-06 | NA | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 3.83E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 3.25E-06 | NA | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 2.01E-06 | NA | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 2.14E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 7.70E-06 | mr1963 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 4.15E-07 | 1.11E-10 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 5.19E-09 | 1.89E-13 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 2.77E-06 | 4.61E-09 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 3.67E-08 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 4.29E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 6.19E-09 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | 2.91E-07 | 2.91E-07 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006197978 | NA | 1.36E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |