\
| Variant ID: vg1006175722 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6175722 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, C: 0.06, others allele: 0.00, population size: 53. )
AAACGGCAAATTGAATTGAGGGCCTGTTTAGATTCCTTGCAAAAATTTTCACAATGTCACATTAAATATTTGGACATATGTATAGAGTATTAAATATAGA[A/C]
AAAAAAAGTAATTACACAGATTGCGTGTAAATTACAAGATGAGTATTTTAAACCTAATCGCTCCATGATCTGACAATGTGGTGCTACATTAAACATTTAC
GTAAATGTTTAATGTAGCACCACATTGTCAGATCATGGAGCGATTAGGTTTAAAATACTCATCTTGTAATTTACACGCAATCTGTGTAATTACTTTTTTT[T/G]
TCTATATTTAATACTCTATACATATGTCCAAATATTTAATGTGACATTGTGAAAATTTTTGCAAGGAATCTAAACAGGCCCTCAATTCAATTTGCCGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.20% | 23.40% | 0.25% | 35.21% | NA |
| All Indica | 2759 | 24.00% | 39.10% | 0.14% | 36.79% | NA |
| All Japonica | 1512 | 79.10% | 0.60% | 0.07% | 20.24% | NA |
| Aus | 269 | 3.00% | 0.70% | 0.00% | 96.28% | NA |
| Indica I | 595 | 2.00% | 86.60% | 0.00% | 11.43% | NA |
| Indica II | 465 | 24.50% | 16.30% | 0.86% | 58.28% | NA |
| Indica III | 913 | 39.20% | 23.30% | 0.00% | 37.46% | NA |
| Indica Intermediate | 786 | 22.50% | 35.00% | 0.00% | 42.49% | NA |
| Temperate Japonica | 767 | 79.30% | 0.50% | 0.00% | 20.21% | NA |
| Tropical Japonica | 504 | 75.80% | 0.60% | 0.00% | 23.61% | NA |
| Japonica Intermediate | 241 | 85.50% | 0.80% | 0.41% | 13.28% | NA |
| VI/Aromatic | 96 | 39.60% | 1.00% | 7.29% | 52.08% | NA |
| Intermediate | 90 | 47.80% | 14.40% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006175722 | A -> C | LOC_Os10g11140.1 | upstream_gene_variant ; 1091.0bp to feature; MODIFIER | silent_mutation | Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1006175722 | A -> C | LOC_Os10g11150.1 | upstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1006175722 | A -> C | LOC_Os10g11140.2 | upstream_gene_variant ; 1091.0bp to feature; MODIFIER | silent_mutation | Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1006175722 | A -> C | LOC_Os10g11140-LOC_Os10g11150 | intergenic_region ; MODIFIER | silent_mutation | Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg1006175722 | A -> DEL | N | N | silent_mutation | Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006175722 | NA | 3.14E-12 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.27E-09 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 3.28E-06 | 3.97E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 3.70E-06 | 1.54E-09 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 9.90E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 1.96E-09 | 3.91E-21 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 8.56E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 3.73E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 3.05E-11 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 3.91E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 5.64E-06 | 4.74E-09 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.69E-26 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 6.70E-09 | 6.16E-22 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 1.82E-07 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 9.94E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.27E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 3.53E-09 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 5.55E-06 | mr1917 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.46E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 8.58E-06 | 8.58E-06 | mr1945 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 1.10E-09 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 9.72E-06 | 8.49E-11 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 9.78E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 6.42E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 8.09E-08 | 3.22E-20 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 7.09E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.10E-11 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 2.96E-06 | NA | mr1161_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 4.34E-06 | 4.91E-12 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 1.82E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 8.25E-11 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 6.51E-06 | 5.95E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 3.05E-25 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | 9.49E-08 | 3.15E-21 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 2.63E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 7.56E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006175722 | NA | 8.38E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |