\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006175722:

Variant ID: vg1006175722 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6175722
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, C: 0.06, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AAACGGCAAATTGAATTGAGGGCCTGTTTAGATTCCTTGCAAAAATTTTCACAATGTCACATTAAATATTTGGACATATGTATAGAGTATTAAATATAGA[A/C]
AAAAAAAGTAATTACACAGATTGCGTGTAAATTACAAGATGAGTATTTTAAACCTAATCGCTCCATGATCTGACAATGTGGTGCTACATTAAACATTTAC

Reverse complement sequence

GTAAATGTTTAATGTAGCACCACATTGTCAGATCATGGAGCGATTAGGTTTAAAATACTCATCTTGTAATTTACACGCAATCTGTGTAATTACTTTTTTT[T/G]
TCTATATTTAATACTCTATACATATGTCCAAATATTTAATGTGACATTGTGAAAATTTTTGCAAGGAATCTAAACAGGCCCTCAATTCAATTTGCCGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 23.40% 0.25% 35.21% NA
All Indica  2759 24.00% 39.10% 0.14% 36.79% NA
All Japonica  1512 79.10% 0.60% 0.07% 20.24% NA
Aus  269 3.00% 0.70% 0.00% 96.28% NA
Indica I  595 2.00% 86.60% 0.00% 11.43% NA
Indica II  465 24.50% 16.30% 0.86% 58.28% NA
Indica III  913 39.20% 23.30% 0.00% 37.46% NA
Indica Intermediate  786 22.50% 35.00% 0.00% 42.49% NA
Temperate Japonica  767 79.30% 0.50% 0.00% 20.21% NA
Tropical Japonica  504 75.80% 0.60% 0.00% 23.61% NA
Japonica Intermediate  241 85.50% 0.80% 0.41% 13.28% NA
VI/Aromatic  96 39.60% 1.00% 7.29% 52.08% NA
Intermediate  90 47.80% 14.40% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006175722 A -> C LOC_Os10g11140.1 upstream_gene_variant ; 1091.0bp to feature; MODIFIER silent_mutation Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1006175722 A -> C LOC_Os10g11150.1 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1006175722 A -> C LOC_Os10g11140.2 upstream_gene_variant ; 1091.0bp to feature; MODIFIER silent_mutation Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1006175722 A -> C LOC_Os10g11140-LOC_Os10g11150 intergenic_region ; MODIFIER silent_mutation Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg1006175722 A -> DEL N N silent_mutation Average:69.579; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006175722 NA 3.14E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.27E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 3.28E-06 3.97E-09 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 3.70E-06 1.54E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 9.90E-16 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 1.96E-09 3.91E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 8.56E-07 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 3.73E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 3.05E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 3.91E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 5.64E-06 4.74E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.69E-26 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 6.70E-09 6.16E-22 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 1.82E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 9.94E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.27E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 3.53E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 5.55E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.46E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 8.58E-06 8.58E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 1.10E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 9.72E-06 8.49E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 9.78E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 6.42E-16 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 8.09E-08 3.22E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 7.09E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.10E-11 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 2.96E-06 NA mr1161_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 4.34E-06 4.91E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 1.82E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 8.25E-11 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 6.51E-06 5.95E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 3.05E-25 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 9.49E-08 3.15E-21 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 2.63E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 7.56E-13 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006175722 NA 8.38E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251