\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006124926:

Variant ID: vg1006124926 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6124926
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTAAAAAGAATTAAATAAATTTAATTCAATTTATGGACAATTTTAATATGTAGATCTTTATTTTATACAACTTTTGCAACTTGAACCACATTAAACT[G/C]
AGTTAGGATGAATTAGTTTTGAATTTTTAAAGATTAAATCGGATTAAAACACTTATATGGATTTTAATTGAATTACGACGCAATAATGAATTATTTTTGA

Reverse complement sequence

TCAAAAATAATTCATTATTGCGTCGTAATTCAATTAAAATCCATATAAGTGTTTTAATCCGATTTAATCTTTAAAAATTCAAAACTAATTCATCCTAACT[C/G]
AGTTTAATGTGGTTCAAGTTGCAAAAGTTGTATAAAATAAAGATCTACATATTAAAATTGTCCATAAATTGAATTAAATTTATTTAATTCTTTTTAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 14.00% 6.41% 5.01% NA
All Indica  2759 78.80% 16.80% 4.28% 0.07% NA
All Japonica  1512 61.00% 12.70% 11.04% 15.21% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.30% 0.70% 1.01% 0.00% NA
Indica II  465 84.70% 9.00% 6.24% 0.00% NA
Indica III  913 61.90% 34.40% 3.61% 0.11% NA
Indica Intermediate  786 80.30% 13.20% 6.36% 0.13% NA
Temperate Japonica  767 64.10% 3.80% 3.52% 28.55% NA
Tropical Japonica  504 54.40% 23.20% 22.22% 0.20% NA
Japonica Intermediate  241 65.10% 19.10% 11.62% 4.15% NA
VI/Aromatic  96 89.60% 1.00% 9.38% 0.00% NA
Intermediate  90 81.10% 3.30% 10.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006124926 G -> C LOC_Os10g11070.1 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47 N N N N
vg1006124926 G -> C LOC_Os10g11080.1 downstream_gene_variant ; 1616.0bp to feature; MODIFIER silent_mutation Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47 N N N N
vg1006124926 G -> C LOC_Os10g11070-LOC_Os10g11080 intergenic_region ; MODIFIER silent_mutation Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47 N N N N
vg1006124926 G -> DEL N N silent_mutation Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006124926 NA 2.73E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 2.48E-06 1.55E-16 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.78E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 5.31E-07 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.54E-11 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.27E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 5.67E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.72E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.07E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 1.81E-13 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 4.39E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 1.49E-07 1.12E-10 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 7.93E-07 4.97E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 3.99E-09 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 2.99E-10 5.59E-11 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926 NA 7.54E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251