Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006124926:

Variant ID: vg1006124926 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6124926
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTTAAAAAGAATTAAATAAATTTAATTCAATTTATGGACAATTTTAATATGTAGATCTTTATTTTATACAACTTTTGCAACTTGAACCACATTAAACT[G/C]
AGTTAGGATGAATTAGTTTTGAATTTTTAAAGATTAAATCGGATTAAAACACTTATATGGATTTTAATTGAATTACGACGCAATAATGAATTATTTTTGA

Reverse complement sequence

TCAAAAATAATTCATTATTGCGTCGTAATTCAATTAAAATCCATATAAGTGTTTTAATCCGATTTAATCTTTAAAAATTCAAAACTAATTCATCCTAACT[C/G]
AGTTTAATGTGGTTCAAGTTGCAAAAGTTGTATAAAATAAAGATCTACATATTAAAATTGTCCATAAATTGAATTAAATTTATTTAATTCTTTTTAAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	14.00%	6.41%	5.01%	NA
All Indica	2759	78.80%	16.80%	4.28%	0.07%	NA
All Japonica	1512	61.00%	12.70%	11.04%	15.21%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	98.30%	0.70%	1.01%	0.00%	NA
Indica II	465	84.70%	9.00%	6.24%	0.00%	NA
Indica III	913	61.90%	34.40%	3.61%	0.11%	NA
Indica Intermediate	786	80.30%	13.20%	6.36%	0.13%	NA
Temperate Japonica	767	64.10%	3.80%	3.52%	28.55%	NA
Tropical Japonica	504	54.40%	23.20%	22.22%	0.20%	NA
Japonica Intermediate	241	65.10%	19.10%	11.62%	4.15%	NA
VI/Aromatic	96	89.60%	1.00%	9.38%	0.00%	NA
Intermediate	90	81.10%	3.30%	10.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006124926	G -> C	LOC_Os10g11070.1	upstream_gene_variant ; 1954.0bp to feature; MODIFIER	silent_mutation	Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47	N	N	N	N
vg1006124926	G -> C	LOC_Os10g11080.1	downstream_gene_variant ; 1616.0bp to feature; MODIFIER	silent_mutation	Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47	N	N	N	N
vg1006124926	G -> C	LOC_Os10g11070-LOC_Os10g11080	intergenic_region ; MODIFIER	silent_mutation	Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47	N	N	N	N
vg1006124926	G -> DEL	N	N	silent_mutation	Average:13.325; most accessible tissue: Zhenshan97 flag leaf, score: 16.47	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006124926	NA	2.73E-10	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	2.48E-06	1.55E-16	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.78E-10	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	5.31E-07	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.54E-11	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.27E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	5.67E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.72E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.07E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	1.81E-13	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	4.39E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	1.49E-07	1.12E-10	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	7.93E-07	4.97E-09	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	3.99E-09	NA	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	2.99E-10	5.59E-11	mr1258_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006124926	NA	7.54E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251