| Variant ID: vg1006058550 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 6058550 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGGGAGGCTAAAGGTCCTTTCGCATAAAGCCGGCATTTCAAAGCAGTAGTTGAAAGCAGTAAAAAAGTTGTAGTAATTAACCCATATTAACCAATCACT[G/A]
TCCAACGCTACACCACGTTGCAACAGGCCCAAACCACCACCTGAACTAACCAGTTCCAAAAGCTAACTAGGGGTGAAACTAATCACGGTGAATCTGGTCG
CGACCAGATTCACCGTGATTAGTTTCACCCCTAGTTAGCTTTTGGAACTGGTTAGTTCAGGTGGTGGTTTGGGCCTGTTGCAACGTGGTGTAGCGTTGGA[C/T]
AGTGATTGGTTAATATGGGTTAATTACTACAACTTTTTTACTGCTTTCAACTACTGCTTTGAAATGCCGGCTTTATGCGAAAGGACCTTTAGCCTCCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.60% | 0.30% | 7.28% | 72.83% | NA |
| All Indica | 2759 | 2.70% | 0.00% | 6.34% | 90.94% | NA |
| All Japonica | 1512 | 51.60% | 0.70% | 8.99% | 38.69% | NA |
| Aus | 269 | 1.50% | 0.00% | 5.20% | 93.31% | NA |
| Indica I | 595 | 1.50% | 0.00% | 1.34% | 97.14% | NA |
| Indica II | 465 | 1.90% | 0.00% | 5.81% | 92.26% | NA |
| Indica III | 913 | 3.30% | 0.00% | 8.76% | 87.95% | NA |
| Indica Intermediate | 786 | 3.40% | 0.00% | 7.63% | 88.93% | NA |
| Temperate Japonica | 767 | 78.20% | 1.40% | 8.34% | 11.99% | NA |
| Tropical Japonica | 504 | 12.90% | 0.00% | 11.11% | 75.99% | NA |
| Japonica Intermediate | 241 | 47.70% | 0.00% | 6.64% | 45.64% | NA |
| VI/Aromatic | 96 | 41.70% | 1.00% | 11.46% | 45.83% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 8.89% | 58.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1006058550 | G -> A | LOC_Os10g10950.1 | synonymous_variant ; p.Asp68Asp; LOW | synonymous_codon | Average:5.316; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| vg1006058550 | G -> DEL | LOC_Os10g10950.1 | N | frameshift_variant | Average:5.316; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1006058550 | NA | 1.19E-06 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | 4.57E-06 | 3.49E-07 | mr1013 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | NA | 3.23E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | 1.60E-06 | 1.28E-07 | mr1034 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | NA | 1.60E-06 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | NA | 1.16E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | NA | 1.38E-06 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1006058550 | NA | 1.26E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/