Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1006051095:

Variant ID: vg1006051095 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6051095
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGCAAGGGGGACACCAGCAGGCCGAGATGAGTGAAGGTTGGGGGTTGGTGACACCAGGCTTGGTTCGGCCAAACCACCCTAGGCCCCAGAGCACCCC[G/A]
GCTCAGGCAGGGTGCAATAGGCTTAGGATGGACTTTAGAGAAAGGACCAAATCCACTAAGTGTATTTCCTATCATAACCCCTCAACTATATTTAGGAAAA

Reverse complement sequence

TTTTCCTAAATATAGTTGAGGGGTTATGATAGGAAATACACTTAGTGGATTTGGTCCTTTCTCTAAAGTCCATCCTAAGCCTATTGCACCCTGCCTGAGC[C/T]
GGGGTGCTCTGGGGCCTAGGGTGGTTTGGCCGAACCAAGCCTGGTGTCACCAACCCCCAACCTTCACTCATCTCGGCCTGCTGGTGTCCCCCTTGCTATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.10% 0.34% 0.00% NA
All Indica  2759 63.50% 36.20% 0.29% 0.00% NA
All Japonica  1512 41.50% 58.30% 0.26% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 89.10% 10.90% 0.00% 0.00% NA
Indica II  465 45.40% 54.20% 0.43% 0.00% NA
Indica III  913 61.10% 38.40% 0.44% 0.00% NA
Indica Intermediate  786 57.80% 42.00% 0.25% 0.00% NA
Temperate Japonica  767 12.30% 87.60% 0.13% 0.00% NA
Tropical Japonica  504 84.90% 14.90% 0.20% 0.00% NA
Japonica Intermediate  241 43.60% 55.60% 0.83% 0.00% NA
VI/Aromatic  96 22.90% 76.00% 1.04% 0.00% NA
Intermediate  90 40.00% 56.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006051095 G -> A LOC_Os10g10904.1 upstream_gene_variant ; 3633.0bp to feature; MODIFIER silent_mutation Average:68.034; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg1006051095 G -> A LOC_Os10g10938.1 upstream_gene_variant ; 405.0bp to feature; MODIFIER silent_mutation Average:68.034; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg1006051095 G -> A LOC_Os10g10920.1 downstream_gene_variant ; 4925.0bp to feature; MODIFIER silent_mutation Average:68.034; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg1006051095 G -> A LOC_Os10g10950.1 downstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:68.034; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N
vg1006051095 G -> A LOC_Os10g10938-LOC_Os10g10950 intergenic_region ; MODIFIER silent_mutation Average:68.034; most accessible tissue: Minghui63 flag leaf, score: 85.5 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1006051095 G A -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006051095 NA 4.75E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.03E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 2.56E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 3.83E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.57E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 3.55E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 9.11E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 5.90E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.42E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 8.76E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 2.47E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.28E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 8.63E-06 1.60E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 5.31E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 2.94E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 5.27E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 4.99E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.88E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 6.58E-07 3.80E-08 mr1580_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 9.97E-10 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 5.02E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 5.06E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.52E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 3.10E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 2.17E-06 1.74E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 1.81E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 9.70E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006051095 NA 2.74E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251