Variant ID: vg1006028591 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 6028591 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TTCCCTAGGCAGAATACCCAAACGAAGATCATACACTGTGCTTTTGCTCTCCACAACTACAGGCTTGACAGTGCGGACCCACATTTCCTGACATAGCATC[C/T]
GTTGTACAACAGGTACCCCAACATCCCACAGGCTCCACCACTACGCGACTGGTACGACGCACCGAACAGTGCAGCGGGGATGCGAGCTGTTCGTGACGCC
GGCGTCACGAACAGCTCGCATCCCCGCTGCACTGTTCGGTGCGTCGTACCAGTCGCGTAGTGGTGGAGCCTGTGGGATGTTGGGGTACCTGTTGTACAAC[G/A]
GATGCTATGTCAGGAAATGTGGGTCCGCACTGTCAAGCCTGTAGTTGTGGAGAGCAAAAGCACAGTGTATGATCTTCGTTTGGGTATTCTGCCTAGGGAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 75.30% | 24.20% | 0.08% | 0.38% | NA |
All Indica | 2759 | 58.90% | 40.40% | 0.14% | 0.58% | NA |
All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
Indica I | 595 | 12.90% | 86.60% | 0.17% | 0.34% | NA |
Indica II | 465 | 76.80% | 22.20% | 0.22% | 0.86% | NA |
Indica III | 913 | 75.80% | 23.80% | 0.00% | 0.44% | NA |
Indica Intermediate | 786 | 63.40% | 35.60% | 0.25% | 0.76% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 85.60% | 13.30% | 0.00% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1006028591 | C -> T | LOC_Os10g10880.1 | downstream_gene_variant ; 592.0bp to feature; MODIFIER | silent_mutation | Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
vg1006028591 | C -> T | LOC_Os10g10890.1 | downstream_gene_variant ; 380.0bp to feature; MODIFIER | silent_mutation | Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
vg1006028591 | C -> T | LOC_Os10g10880-LOC_Os10g10890 | intergenic_region ; MODIFIER | silent_mutation | Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
vg1006028591 | C -> DEL | N | N | silent_mutation | Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1006028591 | 1.32E-09 | 1.25E-41 | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 7.90E-10 | 6.35E-22 | mr1026 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | NA | 4.52E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 2.02E-06 | 1.39E-17 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 1.22E-09 | 1.45E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | NA | 5.05E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 9.82E-09 | 7.46E-39 | mr1161 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 3.29E-09 | 1.64E-20 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | 1.60E-06 | 1.85E-20 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1006028591 | NA | 8.17E-10 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/