Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006028591:

Variant ID: vg1006028591 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 6028591
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCCTAGGCAGAATACCCAAACGAAGATCATACACTGTGCTTTTGCTCTCCACAACTACAGGCTTGACAGTGCGGACCCACATTTCCTGACATAGCATC[C/T]
GTTGTACAACAGGTACCCCAACATCCCACAGGCTCCACCACTACGCGACTGGTACGACGCACCGAACAGTGCAGCGGGGATGCGAGCTGTTCGTGACGCC

Reverse complement sequence

GGCGTCACGAACAGCTCGCATCCCCGCTGCACTGTTCGGTGCGTCGTACCAGTCGCGTAGTGGTGGAGCCTGTGGGATGTTGGGGTACCTGTTGTACAAC[G/A]
GATGCTATGTCAGGAAATGTGGGTCCGCACTGTCAAGCCTGTAGTTGTGGAGAGCAAAAGCACAGTGTATGATCTTCGTTTGGGTATTCTGCCTAGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	24.20%	0.08%	0.38%	NA
All Indica	2759	58.90%	40.40%	0.14%	0.58%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	12.90%	86.60%	0.17%	0.34%	NA
Indica II	465	76.80%	22.20%	0.22%	0.86%	NA
Indica III	913	75.80%	23.80%	0.00%	0.44%	NA
Indica Intermediate	786	63.40%	35.60%	0.25%	0.76%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1006028591	C -> T	LOC_Os10g10880.1	downstream_gene_variant ; 592.0bp to feature; MODIFIER	silent_mutation	Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1006028591	C -> T	LOC_Os10g10890.1	downstream_gene_variant ; 380.0bp to feature; MODIFIER	silent_mutation	Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1006028591	C -> T	LOC_Os10g10880-LOC_Os10g10890	intergenic_region ; MODIFIER	silent_mutation	Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1006028591	C -> DEL	N	N	silent_mutation	Average:55.757; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1006028591	1.32E-09	1.25E-41	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	7.90E-10	6.35E-22	mr1026	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	4.52E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	2.02E-06	1.39E-17	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	1.22E-09	1.45E-20	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	5.05E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	9.82E-09	7.46E-39	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	3.29E-09	1.64E-20	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	1.60E-06	1.85E-20	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	8.17E-10	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	1.39E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	2.30E-08	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	8.84E-06	mr1936	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	6.31E-21	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	1.21E-07	2.16E-24	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	2.73E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	2.31E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	5.68E-06	1.10E-37	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	9.47E-06	4.97E-19	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	1.98E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	7.53E-27	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	9.89E-06	1.60E-22	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	1.51E-09	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	8.13E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	1.11E-08	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	4.06E-09	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006028591	NA	1.78E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251