\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006015012:

Variant ID: vg1006015012 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6015012
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATCACATATGGATATATTCCGACGATTTTTTTAAAAATTATTATTGAATTATTTTTAAATGTTGCACGATGTTTCACCAGGTATATCGGAATTGTTT[T/C]
ACTGAGTAGATCGAAAATGTTTCACTCGTTTAAATCGGGTATTGTTTTACCTTATATAAAAACAATGTTTCAGCAAATAGTGAAAGAATATTTCAGTTCA

Reverse complement sequence

TGAACTGAAATATTCTTTCACTATTTGCTGAAACATTGTTTTTATATAAGGTAAAACAATACCCGATTTAAACGAGTGAAACATTTTCGATCTACTCAGT[A/G]
AAACAATTCCGATATACCTGGTGAAACATCGTGCAACATTTAAAAATAATTCAATAATAATTTTTAAAAAAATCGTCGGAATATATCCATATGTGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 20.60% 7.60% 2.50% NA
All Indica  2759 59.20% 24.10% 12.43% 4.28% NA
All Japonica  1512 83.30% 16.10% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 12.90% 47.10% 31.43% 8.57% NA
Indica II  465 77.80% 13.80% 6.24% 2.15% NA
Indica III  913 75.70% 16.00% 4.93% 3.40% NA
Indica Intermediate  786 64.10% 22.10% 10.43% 3.31% NA
Temperate Japonica  767 69.50% 29.90% 0.65% 0.00% NA
Tropical Japonica  504 99.00% 0.60% 0.40% 0.00% NA
Japonica Intermediate  241 94.20% 5.00% 0.83% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 76.70% 15.60% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006015012 T -> C LOC_Os10g10860.1 upstream_gene_variant ; 1433.0bp to feature; MODIFIER silent_mutation Average:21.434; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1006015012 T -> C LOC_Os10g10870.1 upstream_gene_variant ; 3119.0bp to feature; MODIFIER silent_mutation Average:21.434; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1006015012 T -> C LOC_Os10g10860-LOC_Os10g10870 intergenic_region ; MODIFIER silent_mutation Average:21.434; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1006015012 T -> DEL N N silent_mutation Average:21.434; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006015012 1.55E-07 2.63E-20 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 6.01E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 9.17E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 1.96E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 5.20E-08 1.07E-19 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 2.06E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 3.84E-07 8.55E-19 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 1.10E-06 1.10E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 1.73E-06 3.90E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 8.20E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 3.88E-07 8.27E-12 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 3.51E-20 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 1.90E-09 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 1.58E-06 NA mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 8.88E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 7.46E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 8.42E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 3.83E-07 3.65E-11 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 8.36E-09 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 2.17E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 4.42E-08 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 6.76E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 6.08E-09 1.57E-25 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 2.36E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 7.17E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 2.93E-06 1.02E-18 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 4.17E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 6.77E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 2.19E-07 4.44E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 3.78E-10 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 1.14E-06 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 6.42E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 7.80E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 3.60E-10 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006015012 NA 6.95E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251