\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1006011150:

Variant ID: vg1006011150 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 6011150
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCTAGTCTAGTCTTCCGAAGATGCTATAGGGATAGAGTGTGTCTGCGCGCGCGCATTTCTAGAGATGAGTGTGTGCACGTTATAAGCGTCTACATTT[G/A]
TACTGCGTTTCTTAGAAAATTACAAAGTAAAATGAAATTAAACTTCCTTTTCTTCACCAACCACCATCAAATCTTGGGGAATTTAACTATTTACCATTTT

Reverse complement sequence

AAAATGGTAAATAGTTAAATTCCCCAAGATTTGATGGTGGTTGGTGAAGAAAAGGAAGTTTAATTTCATTTTACTTTGTAATTTTCTAAGAAACGCAGTA[C/T]
AAATGTAGACGCTTATAACGTGCACACACTCATCTCTAGAAATGCGCGCGCGCAGACACACTCTATCCCTATAGCATCTTCGGAAGACTAGACTAGCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.10% 0.02% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 84.70% 15.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 70.90% 28.90% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1006011150 G -> A LOC_Os10g10860.1 downstream_gene_variant ; 415.0bp to feature; MODIFIER silent_mutation Average:55.629; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg1006011150 G -> A LOC_Os10g10840-LOC_Os10g10860 intergenic_region ; MODIFIER silent_mutation Average:55.629; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1006011150 NA 2.73E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 7.61E-07 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 8.92E-07 8.92E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 9.45E-11 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 1.40E-07 3.62E-12 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 4.91E-11 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 5.36E-08 2.28E-12 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 1.13E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 NA 1.99E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 2.62E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 8.13E-06 1.61E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 4.82E-13 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 1.81E-08 1.44E-12 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 2.03E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 NA 5.05E-09 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 NA 2.55E-07 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 2.00E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 NA 4.30E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 1.05E-07 6.43E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1006011150 NA 2.03E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251