\
| Variant ID: vg1005914542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5914542 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.02, others allele: 0.00, population size: 122. )
TTTGCGGTAAATCGAAGAAGCTTATTAACTTTCTGTGAGTTTACAGAAAAATAATTAATATCTATAATAAAAATAAATAGAATAAAACACATTATAACAT[A/T]
ACAACCTATCAGTGCCACCTCTATAGTGTCTAACTGTCTATTGGATAAAACATAGCGCCACTACATGTCCTCTCAAACCATGTGCGCTCTGCAGACAAGA
TCTTGTCTGCAGAGCGCACATGGTTTGAGAGGACATGTAGTGGCGCTATGTTTTATCCAATAGACAGTTAGACACTATAGAGGTGGCACTGATAGGTTGT[T/A]
ATGTTATAATGTGTTTTATTCTATTTATTTTTATTATAGATATTAATTATTTTTCTGTAAACTCACAGAAAGTTAATAAGCTTCTTCGATTTACCGCAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 29.10% | 0.19% | 0.91% | NA |
| All Indica | 2759 | 51.30% | 48.10% | 0.33% | 0.25% | NA |
| All Japonica | 1512 | 98.80% | 1.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.40% | 87.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 54.60% | 44.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 68.30% | 30.80% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 58.90% | 40.60% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 60.40% | 8.30% | 0.00% | 31.25% | NA |
| Intermediate | 90 | 73.30% | 21.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005914542 | A -> T | LOC_Os10g10720.1 | upstream_gene_variant ; 1965.0bp to feature; MODIFIER | silent_mutation | Average:61.202; most accessible tissue: Callus, score: 88.807 | N | N | N | N |
| vg1005914542 | A -> T | LOC_Os10g10700-LOC_Os10g10720 | intergenic_region ; MODIFIER | silent_mutation | Average:61.202; most accessible tissue: Callus, score: 88.807 | N | N | N | N |
| vg1005914542 | A -> DEL | N | N | silent_mutation | Average:61.202; most accessible tissue: Callus, score: 88.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005914542 | 1.68E-06 | 6.07E-44 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 5.32E-06 | 6.71E-19 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 5.74E-09 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 9.54E-06 | 9.67E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 3.72E-09 | 2.44E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 4.17E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 3.44E-06 | 6.50E-43 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 7.99E-06 | 7.25E-19 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 5.65E-10 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 3.60E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 4.77E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 1.86E-16 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 6.90E-09 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 1.02E-06 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 4.37E-06 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 1.19E-09 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 3.44E-20 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 2.78E-10 | 4.71E-28 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 1.53E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 2.46E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 9.36E-06 | 1.10E-41 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 7.54E-06 | 2.61E-18 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 3.18E-10 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 2.77E-08 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 5.01E-06 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 5.68E-23 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | 7.85E-07 | 7.70E-21 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 4.04E-12 | mr1496_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 9.68E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 1.07E-07 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005914542 | NA | 2.61E-09 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |