\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005864251:

Variant ID: vg1005864251 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5864251
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAGCTGTATCGAGACTACGATGATGGGTACGTATCCACTCCCTGCCCGTCACCACCATTAGATCTGTTCGATGCCGAAGAAAATTTGGAGTATGGAGA[T/C]
GAGGGAGATGATAATTGGATGCATGGGGATGTGTTCGCTGAGAGTAAGAAATCGAAAAATGTAGCTTCGCCGCCGAGCAAGCGCAAGAAGTTTTAGAATA

Reverse complement sequence

TATTCTAAAACTTCTTGCGCTTGCTCGGCGGCGAAGCTACATTTTTCGATTTCTTACTCTCAGCGAACACATCCCCATGCATCCAATTATCATCTCCCTC[A/G]
TCTCCATACTCCAAATTTTCTTCGGCATCGAACAGATCTAATGGTGGTGACGGGCAGGGAGTGGATACGTACCCATCATCGTAGTCTCGATACAGCTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 25.60% 0.13% 0.00% NA
All Indica  2759 72.80% 27.10% 0.07% 0.00% NA
All Japonica  1512 72.70% 27.10% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.10% 8.70% 0.17% 0.00% NA
Indica II  465 70.10% 29.90% 0.00% 0.00% NA
Indica III  913 66.60% 33.30% 0.11% 0.00% NA
Indica Intermediate  786 67.70% 32.30% 0.00% 0.00% NA
Temperate Japonica  767 92.60% 7.40% 0.00% 0.00% NA
Tropical Japonica  504 36.10% 63.50% 0.40% 0.00% NA
Japonica Intermediate  241 85.90% 13.70% 0.41% 0.00% NA
VI/Aromatic  96 74.00% 25.00% 1.04% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005864251 T -> C LOC_Os10g10620.1 downstream_gene_variant ; 2291.0bp to feature; MODIFIER silent_mutation Average:48.57; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg1005864251 T -> C LOC_Os10g10610.1 intron_variant ; MODIFIER silent_mutation Average:48.57; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005864251 NA 8.01E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.44E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 6.27E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.25E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 7.72E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 5.46E-11 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.19E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.34E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 4.14E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.04E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 3.82E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 2.23E-10 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 3.74E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 2.43E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 6.96E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.34E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 3.69E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.35E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.92E-09 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.93E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 8.25E-06 4.86E-11 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 4.86E-08 mr1830_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 5.47E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 1.84E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005864251 NA 4.03E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251