\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005834536:

Variant ID: vg1005834536 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5834536
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGTAAAAAAAAAATCTGAACCGTTGATCTCATTTGATCGAAGGGTTCAGATCTATTTCTACTACCACCTCACTTAATGGTAGTAGAATTATGGAGGA[G/A]
TATTTTTGTCCAGATAAAATCATGTACCTGGTTGCTGATGATTCAGCAGTGTCATAGTAATGGAAATCCTGATTTCCCTTTAAAAAAAGAATTATGGAGA

Reverse complement sequence

TCTCCATAATTCTTTTTTTAAAGGGAAATCAGGATTTCCATTACTATGACACTGCTGAATCATCAGCAACCAGGTACATGATTTTATCTGGACAAAAATA[C/T]
TCCTCCATAATTCTACTACCATTAAGTGAGGTGGTAGTAGAAATAGATCTGAACCCTTCGATCAAATGAGATCAACGGTTCAGATTTTTTTTTTACTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 25.40% 0.06% 0.00% NA
All Indica  2759 73.00% 27.00% 0.00% 0.00% NA
All Japonica  1512 73.00% 26.90% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 70.80% 29.20% 0.00% 0.00% NA
Indica III  913 66.90% 33.10% 0.00% 0.00% NA
Indica Intermediate  786 67.70% 32.30% 0.00% 0.00% NA
Temperate Japonica  767 92.70% 7.30% 0.00% 0.00% NA
Tropical Japonica  504 36.70% 62.90% 0.40% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005834536 G -> A LOC_Os10g10560.1 upstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:71.317; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg1005834536 G -> A LOC_Os10g10570.1 upstream_gene_variant ; 3238.0bp to feature; MODIFIER silent_mutation Average:71.317; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg1005834536 G -> A LOC_Os10g10550.1 downstream_gene_variant ; 2324.0bp to feature; MODIFIER silent_mutation Average:71.317; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg1005834536 G -> A LOC_Os10g10560-LOC_Os10g10570 intergenic_region ; MODIFIER silent_mutation Average:71.317; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005834536 G A 0.08 0.01 0.0 -0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005834536 NA 2.23E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.67E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.23E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 9.35E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 4.24E-11 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.31E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 7.99E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 1.86E-06 2.42E-07 mr1195_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 9.05E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 4.66E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 2.22E-10 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.90E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 4.71E-07 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.98E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.73E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 7.77E-11 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 5.01E-08 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 3.30E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005834536 NA 1.81E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251