Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005832870:

Variant ID: vg1005832870 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5832870
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TAACGATGCAAAGACAACCAGATCAATATTCCAACATGTAAACAGCCCAGGCGTCCTAAACAATTAATTGCTAGCAACCGGAATATGATCTGCTAGTACA[A/G]
TATTTGCTCAGTACTGAGCAGATTGATCAGATTCTAATATAATAATCGTTTAGATTTGCATGTATGTGGTAGTACGTACAATACGTTTCTATGTCCAAAG

Reverse complement sequence

CTTTGGACATAGAAACGTATTGTACGTACTACCACATACATGCAAATCTAAACGATTATTATATTAGAATCTGATCAATCTGCTCAGTACTGAGCAAATA[T/C]
TGTACTAGCAGATCATATTCCGGTTGCTAGCAATTAATTGTTTAGGACGCCTGGGCTGTTTACATGTTGGAATATTGATCTGGTTGTCTTTGCATCGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.00%	0.04%	0.00%	NA
All Indica	2759	97.70%	2.30%	0.00%	0.00%	NA
All Japonica	1512	72.30%	27.60%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	94.50%	5.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	91.90%	8.00%	0.13%	0.00%	NA
Tropical Japonica	504	34.90%	65.10%	0.00%	0.00%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005832870	A -> G	LOC_Os10g10570.1	upstream_gene_variant ; 4904.0bp to feature; MODIFIER	silent_mutation	Average:49.066; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg1005832870	A -> G	LOC_Os10g10540.1	downstream_gene_variant ; 4723.0bp to feature; MODIFIER	silent_mutation	Average:49.066; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg1005832870	A -> G	LOC_Os10g10550.1	downstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:49.066; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg1005832870	A -> G	LOC_Os10g10560.1	downstream_gene_variant ; 736.0bp to feature; MODIFIER	silent_mutation	Average:49.066; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg1005832870	A -> G	LOC_Os10g10550-LOC_Os10g10560	intergenic_region ; MODIFIER	silent_mutation	Average:49.066; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005832870	NA	5.91E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	5.30E-07	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	9.14E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	1.17E-06	NA	mr1281_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	3.51E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	4.42E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	4.79E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	2.70E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	1.30E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	1.32E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	5.89E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	1.62E-09	5.52E-09	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	1.25E-09	3.56E-17	mr1842_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	NA	6.53E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005832870	1.46E-06	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251