| Variant ID: vg1005826161 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5826161 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 309. )
GATAATTAACTTAAGTAATAGTGTATTAGGCCCCTTTCCAAACACCCTTGGGGCCATTGCCTGGAAACATAGAATGGTCACACGATATATATGATGCATC[T/G]
ATTTGTTGCAGCTGGTCCAAGATCATACTCCTACGAGGAATTGTACACTGCAACAAATGGTTTTTCAGATGAACGAAAGTTGGGCCAGGGTGCGTTTGGT
ACCAAACGCACCCTGGCCCAACTTTCGTTCATCTGAAAAACCATTTGTTGCAGTGTACAATTCCTCGTAGGAGTATGATCTTGGACCAGCTGCAACAAAT[A/C]
GATGCATCATATATATCGTGTGACCATTCTATGTTTCCAGGCAATGGCCCCAAGGGTGTTTGGAAAGGGGCCTAATACACTATTACTTAAGTTAATTATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.90% | 28.70% | 0.34% | 0.06% | NA |
| All Indica | 2759 | 77.20% | 22.30% | 0.51% | 0.07% | NA |
| All Japonica | 1512 | 54.80% | 45.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.30% | 23.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 62.70% | 36.50% | 0.66% | 0.22% | NA |
| Indica Intermediate | 786 | 78.20% | 21.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.70% | 86.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005826161 | T -> G | LOC_Os10g10540.1 | intron_variant ; MODIFIER | silent_mutation | Average:71.822; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg1005826161 | T -> DEL | N | N | silent_mutation | Average:71.822; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005826161 | NA | 4.70E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | 3.81E-06 | 4.99E-10 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | 2.05E-06 | 3.98E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | 4.61E-07 | 1.13E-10 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | 9.01E-08 | 7.18E-30 | mr1118 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | 9.32E-10 | 3.02E-20 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | NA | 1.38E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | NA | 1.55E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | NA | 1.18E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005826161 | NA | 2.17E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/