\
| Variant ID: vg1005820821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5820821 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )
TGCCTTATCACAGGCAGCTACCAATGCCGCTGATACATTTTCACAGGCGATTGGCTGTCTATGACAATAAATTTATAGAGGCGGCTTGTGCCTCCATCCT[T/A]
GATCCAAATTTATGATAGGCGGATCTAGTTTTAGCTGGCCGTCTGTACATAGTAAGAGGAGTGTAAGAAAAACAAATCAAAACGGAGTCAGTTATACTAA
TTAGTATAACTGACTCCGTTTTGATTTGTTTTTCTTACACTCCTCTTACTATGTACAGACGGCCAGCTAAAACTAGATCCGCCTATCATAAATTTGGATC[A/T]
AGGATGGAGGCACAAGCCGCCTCTATAAATTTATTGTCATAGACAGCCAATCGCCTGTGAAAATGTATCAGCGGCATTGGTAGCTGCCTGTGATAAGGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 10.90% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 81.20% | 18.20% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.40% | 0.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 78.10% | 20.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 70.40% | 29.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 82.20% | 17.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 0.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005820821 | T -> A | LOC_Os10g10530.1 | upstream_gene_variant ; 3476.0bp to feature; MODIFIER | silent_mutation | Average:58.656; most accessible tissue: Callus, score: 87.861 | N | N | N | N |
| vg1005820821 | T -> A | LOC_Os10g10540.1 | upstream_gene_variant ; 404.0bp to feature; MODIFIER | silent_mutation | Average:58.656; most accessible tissue: Callus, score: 87.861 | N | N | N | N |
| vg1005820821 | T -> A | LOC_Os10g10530-LOC_Os10g10540 | intergenic_region ; MODIFIER | silent_mutation | Average:58.656; most accessible tissue: Callus, score: 87.861 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005820821 | 3.36E-06 | NA | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 3.74E-11 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 4.59E-06 | 3.77E-10 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 9.28E-06 | 2.79E-09 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 3.21E-08 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 9.14E-09 | 1.08E-19 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 4.03E-07 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 8.16E-07 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 8.00E-06 | mr1123 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.07E-10 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 6.98E-15 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 7.54E-09 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 5.18E-06 | 4.43E-09 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 5.30E-06 | mr1261 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 1.31E-07 | 6.71E-21 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.16E-06 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 3.81E-14 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 2.34E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.82E-12 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.84E-09 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 2.84E-07 | mr1936 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.80E-10 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.40E-11 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 1.78E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 4.11E-07 | 9.38E-18 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 5.61E-08 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 3.06E-11 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | NA | 7.88E-10 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 1.56E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 2.85E-06 | 1.76E-08 | mr1258_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005820821 | 8.24E-08 | 1.68E-20 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |