\
| Variant ID: vg1005803813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5803813 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 200. )
AACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTTAACTCAATTGCTCTCTAAAGCGATACCGGGAAGCCTCACGCTCCCC[C/T]
CTCTATTTATACATGAGGTAGGCAGCCTAAAGCCCCGAACCAAACTCATACTAGGAGTCCTAAACACCTTAGGAAACCCACTAGTACAAGAAAGAAACTT
AAGTTTCTTTCTTGTACTAGTGGGTTTCCTAAGGTGTTTAGGACTCCTAGTATGAGTTTGGTTCGGGGCTTTAGGCTGCCTACCTCATGTATAAATAGAG[G/A]
GGGGAGCGTGAGGCTTCCCGGTATCGCTTTAGAGAGCAATTGAGTTAAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.10% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 73.20% | 26.00% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 14.50% | 83.30% | 2.23% | 0.00% | NA |
| Indica I | 595 | 89.90% | 9.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 72.70% | 26.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 69.70% | 30.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 65.00% | 33.60% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 22.90% | 8.33% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 15.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005803813 | C -> T | LOC_Os10g10520.1 | upstream_gene_variant ; 812.0bp to feature; MODIFIER | silent_mutation | Average:38.99; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1005803813 | C -> T | LOC_Os10g10520-LOC_Os10g10530 | intergenic_region ; MODIFIER | silent_mutation | Average:38.99; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005803813 | NA | 1.90E-10 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 1.25E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 5.77E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 4.34E-10 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 6.27E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 2.83E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 2.45E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 1.17E-07 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 5.49E-09 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 5.03E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 7.20E-06 | mr1790_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | 2.24E-06 | 8.92E-11 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 9.27E-06 | mr1912_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 6.96E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005803813 | NA | 9.99E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |