RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1005802057:

Variant ID: vg1005802057 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5802057
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 354. )

Flanking Sequence (100 bp) in Reference Genome:

CACCATCTACATCACTTAGTGGCTCGAAGGCGGCGCAAACTTGTTGAAAAGCCTTCCTAAGATTCTCCATCTTCCTCCCTTGGTTAGAACCCTTCGACTT[G/A]
TTGTAGTTGGGCTTGTTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGCTTAGGACAATGCGAACGAAGATGATCAATTGAAC

Reverse complement sequence

GTTCAATTGATCATCTTCGTTCGCATTGTCCTAAGCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAACAAGCCCAACTACAA[C/T]
AAGTCGAAGGGTTCTAACCAAGGGAGGAAGATGGAGAATCTTAGGAAGGCTTTTCAACAAGTTTGCGCCGCCTTCGAGCCACTAAGTGATGTAGATGGTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	7.40%	5.40%	2.77%	NA
All Indica	2759	74.00%	12.20%	9.10%	4.68%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	91.40%	4.00%	3.70%	0.84%	NA
Indica II	465	71.20%	9.20%	11.83%	7.74%	NA
Indica III	913	69.30%	15.00%	9.64%	6.02%	NA
Indica Intermediate	786	67.90%	16.90%	10.94%	4.20%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	5.60%	3.33%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005802057	G -> A	LOC_Os10g10520.1	synonymous_variant ; p.Asn315Asn; LOW	synonymous_codon	Average:20.52; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N
vg1005802057	G -> DEL	LOC_Os10g10520.1	N	frameshift_variant	Average:20.52; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005802057	9.38E-06	2.05E-11	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005802057	NA	7.80E-06	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005802057	1.09E-06	8.58E-12	mr1580_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005802057	2.43E-06	6.81E-08	mr1790_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005802057	1.11E-06	4.69E-12	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005802057	NA	2.50E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1005802057:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact