\
| Variant ID: vg1005802057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5802057 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 354. )
CACCATCTACATCACTTAGTGGCTCGAAGGCGGCGCAAACTTGTTGAAAAGCCTTCCTAAGATTCTCCATCTTCCTCCCTTGGTTAGAACCCTTCGACTT[G/A]
TTGTAGTTGGGCTTGTTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGCTTAGGACAATGCGAACGAAGATGATCAATTGAAC
GTTCAATTGATCATCTTCGTTCGCATTGTCCTAAGCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAACAAGCCCAACTACAA[C/T]
AAGTCGAAGGGTTCTAACCAAGGGAGGAAGATGGAGAATCTTAGGAAGGCTTTTCAACAAGTTTGCGCCGCCTTCGAGCCACTAAGTGATGTAGATGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 7.40% | 5.40% | 2.77% | NA |
| All Indica | 2759 | 74.00% | 12.20% | 9.10% | 4.68% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 4.00% | 3.70% | 0.84% | NA |
| Indica II | 465 | 71.20% | 9.20% | 11.83% | 7.74% | NA |
| Indica III | 913 | 69.30% | 15.00% | 9.64% | 6.02% | NA |
| Indica Intermediate | 786 | 67.90% | 16.90% | 10.94% | 4.20% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 5.60% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005802057 | G -> A | LOC_Os10g10520.1 | synonymous_variant ; p.Asn315Asn; LOW | synonymous_codon | Average:20.52; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| vg1005802057 | G -> DEL | LOC_Os10g10520.1 | N | frameshift_variant | Average:20.52; most accessible tissue: Zhenshan97 root, score: 27.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005802057 | 9.38E-06 | 2.05E-11 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005802057 | NA | 7.80E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005802057 | 1.09E-06 | 8.58E-12 | mr1580_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005802057 | 2.43E-06 | 6.81E-08 | mr1790_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005802057 | 1.11E-06 | 4.69E-12 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005802057 | NA | 2.50E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |