\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005798437:

Variant ID: vg1005798437 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 5798437
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTCTCTATTAAGAAAATTTGGTTTATTTTTTTTCCACCAAAAAATATTTCACCTAGTGTACTCACAATGTTTTACTATGTAATATGTATAGATCTAAT[G/A]
TTGCAGTGAACGAAACATTTCATTGTAACAAAAAACCCACATATTTTAGAAACCCCCTATTAAGGGAATTTGATTTATTTTTTTTCCACCGAAAAATGTT

Reverse complement sequence

AACATTTTTCGGTGGAAAAAAAATAAATCAAATTCCCTTAATAGGGGGTTTCTAAAATATGTGGGTTTTTTGTTACAATGAAATGTTTCGTTCACTGCAA[C/T]
ATTAGATCTATACATATTACATAGTAAAACATTGTGAGTACACTAGGTGAAATATTTTTTGGTGGAAAAAAAATAAACCAAATTTTCTTAATAGAGAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 14.60% 8.06% 15.64% NA
All Indica  2759 53.60% 17.60% 3.95% 24.86% NA
All Japonica  1512 85.50% 12.80% 1.39% 0.26% NA
Aus  269 4.10% 0.00% 81.78% 14.13% NA
Indica I  595 88.90% 1.20% 0.84% 9.08% NA
Indica II  465 50.50% 17.60% 2.80% 29.03% NA
Indica III  913 39.20% 27.90% 5.26% 27.60% NA
Indica Intermediate  786 45.30% 18.10% 5.47% 31.17% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 81.20% 16.10% 2.78% 0.00% NA
Japonica Intermediate  241 62.20% 33.20% 2.90% 1.66% NA
VI/Aromatic  96 75.00% 0.00% 23.96% 1.04% NA
Intermediate  90 70.00% 10.00% 8.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005798437 G -> A LOC_Os10g10510.1 downstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:80.774; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg1005798437 G -> A LOC_Os10g10520.1 downstream_gene_variant ; 1774.0bp to feature; MODIFIER silent_mutation Average:80.774; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg1005798437 G -> A LOC_Os10g10510-LOC_Os10g10520 intergenic_region ; MODIFIER silent_mutation Average:80.774; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N
vg1005798437 G -> DEL N N silent_mutation Average:80.774; most accessible tissue: Minghui63 panicle, score: 93.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005798437 NA 5.94E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 6.03E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 6.43E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.02E-07 2.63E-11 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 6.43E-08 2.06E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 6.74E-07 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 6.11E-08 2.04E-11 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.84E-10 3.87E-22 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 4.91E-06 9.28E-10 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 4.16E-06 5.53E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 1.61E-11 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 1.00E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.99E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.54E-08 2.92E-11 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.92E-08 6.71E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 6.40E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 3.87E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 5.28E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 2.79E-10 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 4.60E-06 2.02E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 2.78E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 3.17E-11 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 1.79E-11 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 3.37E-09 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 3.84E-07 2.85E-20 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 3.89E-09 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 2.87E-06 1.93E-13 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 3.08E-06 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 4.69E-07 4.09E-13 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 7.60E-12 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 1.24E-08 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 2.41E-07 1.13E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 2.40E-06 1.03E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 1.00E-16 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 6.82E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798437 NA 2.16E-07 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251