\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1005798322:

Variant ID: vg1005798322 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 5798322
Reference Allele: AAlternative Allele: C,AC,AAC
Primary Allele: CSecondary Allele: AC

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, C: 0.39, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCTGGATCGGTCGCTCCCCACACGTGTCTTCCACATTAGGCCCCACCACGTGTCCCTATCCACCTGCCACTTATCCGCACATAACTCTATTAAAAAAA[A/C,AC,AAC]
CCACATATTTTAAAAACTCTCTATTAAGAAAATTTGGTTTATTTTTTTTCCACCAAAAAATATTTCACCTAGTGTACTCACAATGTTTTACTATGTAATA

Reverse complement sequence

TATTACATAGTAAAACATTGTGAGTACACTAGGTGAAATATTTTTTGGTGGAAAAAAAATAAACCAAATTTTCTTAATAGAGAGTTTTTAAAATATGTGG[T/G,GT,GTT]
TTTTTTTAATAGAGTTATGTGCGGATAAGTGGCAGGTGGATAGGGACACGTGGTGGGGCCTAATGTGGAAGACACGTGTGGGGAGCGACCGATCCAGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of AC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 26.80% 0.78% 0.89% A: 25.12%; AAC: 0.02%
All Indica  2759 73.10% 21.90% 0.91% 1.38% A: 2.68%
All Japonica  1512 6.80% 22.90% 0.53% 0.13% A: 69.64%
Aus  269 2.60% 97.00% 0.00% 0.00% A: 0.37%
Indica I  595 94.30% 3.20% 1.18% 0.84% A: 0.50%
Indica II  465 74.00% 21.70% 0.65% 2.15% A: 1.51%
Indica III  913 60.40% 32.10% 0.88% 0.99% A: 5.70%
Indica Intermediate  786 71.40% 24.40% 0.89% 1.78% A: 1.53%
Temperate Japonica  767 8.90% 15.30% 0.26% 0.00% A: 75.62%
Tropical Japonica  504 3.20% 24.80% 0.60% 0.20% A: 71.23%
Japonica Intermediate  241 7.90% 43.20% 1.24% 0.41% A: 47.30%
VI/Aromatic  96 33.30% 36.50% 3.12% 0.00% A: 26.04%; AAC: 1.04%
Intermediate  90 38.90% 20.00% 1.11% 2.22% A: 37.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1005798322 A -> AAC LOC_Os10g10510.1 downstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> AAC LOC_Os10g10520.1 downstream_gene_variant ; 1888.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> AAC LOC_Os10g10510-LOC_Os10g10520 intergenic_region ; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> C LOC_Os10g10510.1 downstream_gene_variant ; 2408.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> C LOC_Os10g10520.1 downstream_gene_variant ; 1889.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> C LOC_Os10g10510-LOC_Os10g10520 intergenic_region ; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> AC LOC_Os10g10510.1 downstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> AC LOC_Os10g10520.1 downstream_gene_variant ; 1888.0bp to feature; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> AC LOC_Os10g10510-LOC_Os10g10520 intergenic_region ; MODIFIER silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N
vg1005798322 A -> DEL N N silent_mutation Average:91.739; most accessible tissue: Minghui63 panicle, score: 96.34 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1005798322 A AAC 0.04 0.0 0.05 0.0 0.04 0.05
vg1005798322 A AC -0.05 -0.08 -0.05 -0.02 -0.01 0.0
vg1005798322 A C 0.0 -0.05 -0.04 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1005798322 9.23E-09 1.82E-50 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 7.34E-09 1.98E-18 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 9.79E-06 1.29E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 1.71E-06 1.70E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 2.57E-06 9.32E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 2.14E-11 9.76E-23 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 2.16E-07 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.55E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 3.33E-06 mr1123 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 1.29E-07 1.66E-47 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 9.66E-08 2.07E-16 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 4.38E-06 1.49E-08 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.93E-19 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 6.06E-09 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 6.71E-11 6.44E-23 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 6.70E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 4.97E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.21E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 2.08E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.61E-21 mr1913 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 5.33E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.18E-09 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 5.09E-06 2.21E-09 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 1.09E-06 2.71E-10 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 9.36E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 3.66E-11 1.39E-24 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 9.87E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 9.32E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 2.35E-06 3.57E-12 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 6.55E-07 5.78E-46 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 5.13E-08 9.21E-17 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 5.91E-06 5.43E-11 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 1.17E-07 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 1.78E-07 8.06E-09 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 2.91E-11 8.54E-24 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 3.54E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.55E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.53E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005798322 NA 1.60E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251