\
| Variant ID: vg1005760390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 5760390 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 117. )
GCATTCAAATTTTTCATAAAACGTTTTTGGAATTATTCTCCAGGTAGTTGCATGGCTTGATAACTACTCCCTCCATCCCAAAATGTTTGACACCGTTGAC[T/A]
TTTTAAAAAATATTTGACCATTCATCTTATTCAAAAAATTTAAGTAATTATTAATTTTTTTCCTATCATTTGATTTATTGTTAAATATTTTTATTTATAC
GTATAAATAAAAATATTTAACAATAAATCAAATGATAGGAAAAAAATTAATAATTACTTAAATTTTTTGAATAAGATGAATGGTCAAATATTTTTTAAAA[A/T]
GTCAACGGTGTCAAACATTTTGGGATGGAGGGAGTAGTTATCAAGCCATGCAACTACCTGGAGAATAATTCCAAAAACGTTTTATGAAAAATTTGAATGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 23.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 70.90% | 28.90% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.10% | 29.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 66.80% | 32.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 61.80% | 38.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1005760390 | T -> A | LOC_Os10g10480.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.271; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1005760390 | NA | 1.01E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 6.27E-12 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 5.67E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 4.69E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | 9.47E-06 | NA | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | 6.26E-06 | 3.77E-10 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 2.20E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 1.85E-12 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 2.59E-08 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 1.29E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 3.88E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | 4.23E-06 | NA | mr1825_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | 3.92E-06 | 2.96E-10 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1005760390 | NA | 1.71E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |