RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1005758603:

Variant ID: vg1005758603 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 5758603
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAATTTCTATTATTTCTTAATTGTATTTTTATATGGACTCTATACTCTACTTCTAATATTCCTTATTTTTAATTCTGAATTTCTATTATTTATTAATT[G/A]
TATTTCTATATGGACTCTATGATCTTCTTTTAATATTCTTTATTTTTTAATTCCGAATTTCAGTTATTTATAAATTGTATTTCTATATGGACTCCAGTCT

Reverse complement sequence

AGACTGGAGTCCATATAGAAATACAATTTATAAATAACTGAAATTCGGAATTAAAAAATAAAGAATATTAAAAGAAGATCATAGAGTCCATATAGAAATA[C/T]
AATTAATAAATAATAGAAATTCAGAATTAAAAATAAGGAATATTAGAAGTAGAGTATAGAGTCCATATAAAAATACAATTAAGAAATAATAGAAATTTGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	28.00%	0.17%	1.02%	NA
All Indica	2759	53.20%	46.40%	0.11%	0.33%	NA
All Japonica	1512	98.70%	1.10%	0.00%	0.13%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	13.40%	86.40%	0.17%	0.00%	NA
Indica II	465	55.70%	44.30%	0.00%	0.00%	NA
Indica III	913	70.20%	29.10%	0.00%	0.66%	NA
Indica Intermediate	786	62.10%	37.30%	0.25%	0.38%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.30%	2.90%	0.00%	0.83%	NA
VI/Aromatic	96	55.20%	7.30%	2.08%	35.42%	NA
Intermediate	90	75.60%	21.10%	0.00%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1005758603	G -> A	LOC_Os10g10480.1	upstream_gene_variant ; 1115.0bp to feature; MODIFIER	silent_mutation	Average:18.53; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1005758603	G -> A	LOC_Os10g10460-LOC_Os10g10480	intergenic_region ; MODIFIER	silent_mutation	Average:18.53; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1005758603	G -> DEL	N	N	silent_mutation	Average:18.53; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1005758603	1.39E-06	1.74E-44	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	6.16E-06	7.26E-20	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	NA	2.20E-09	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	NA	4.92E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	3.03E-07	1.49E-17	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	2.03E-06	2.17E-43	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	6.30E-06	7.49E-20	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	NA	6.88E-10	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	NA	1.04E-06	mr1237	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1005758603	NA	2.45E-15	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 31 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1005758603:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact